1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rewona [7]
3 years ago
9

A.5 B.6 C.10 D.12 Help plz question is 30 points!

Biology
2 answers:
Gennadij [26K]3 years ago
8 0
The correct answer is B. 6
Umnica [9.8K]3 years ago
6 0

B.) 6

"Krebs Cycle. Two acetyl-CoA molecules enter the cycle, and each has two carbon atoms, so four carbon dioxide molecules will form. Add these four molecules to the two carbon dioxide molecules formed in the conversion of pyruvic acid to acetyl-CoA, and it adds up to six carbon dioxide molecules."

You might be interested in
Which factor affects the force of gravity between objects? Check all that apply.
vagabundo [1.1K]
Mass and distance

mark me brainliest!!!!!
8 0
4 years ago
Read 2 more answers
Organisms that grow in the absence of free oxygen are know as
gayaneshka [121]
Anaerobes/ Anaerobic organisms
7 0
3 years ago
Read 2 more answers
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Pls hurry!!! if u can’t see the pic don’t bother answering
Stella [2.4K]

Answer:

Sewer is not a watershed

4 0
3 years ago
Read 2 more answers
Did starch diffuse through the membrane?
Anna [14]

Answer: Starch did not diffuse through the membrane because the starch turned blue due to the presence of iodine in the dialysis bag

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • Can someone help me with this biology please
    11·1 answer
  • Match the following items. 1. semipermeable; allows certain substances to pass through plasma membrane 2. controls activities of
    13·2 answers
  • Explain how a mutation causing resistance to pyrethrins and pyrethroids would spread through a population of bed bugs that are b
    13·2 answers
  • Select all that apply.
    7·2 answers
  • How do the two species that make up a lichen benefit from their symbiotic association? (Select all that apply.)
    9·1 answer
  • Hyaline cartilage is composed of a semi solid matrix called ground substance. The major component(s) of ground substance is/are
    8·1 answer
  • What kind of organism is a zooxanthellae
    15·2 answers
  • When two separate parent plant are involved in the pollination process
    7·1 answer
  • Dams have a limited effect on rivers and streams.<br> True Or False?
    6·2 answers
  • The grouping that includes turtles, lizards and snakes, crocodiles and alligators, birds, and bats is: _____.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!