1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Svetach [21]
3 years ago
12

A significant threat or danger to health that requires immediate correction or closure to prevent injury is:

Biology
1 answer:
skad [1K]3 years ago
7 0
Make sure you're safe and if u get hurt severely, rush you a hospital
You might be interested in
What is El Niño?
Lyrx [107]
El niño is the boy ,la niña is the girl, el niño y la niña son differentes porque un niño tiene differente tipos de vida que las niñas los niños no van a tener vos de mujer y takpoco los niñas vos de hombre.(english: the boy and the girl are different because they have different types if lifes like a girl wouldnt have a deep voice nor a boy would have a squeek voice)
4 0
3 years ago
Read 2 more answers
In the amoeba, water input and output are controlled by the _____.
LenKa [72]
<span>Amoeba obtain nutrition by holozoic mode. It engulfs food, which remains iside the vacoule where digestion takes place. Vacoule move inside and fuse with lysosome, which releases proteases and amylase for digection of the engulfed food. The digested food is absorbed by the cell. Undigesed food remains in the vacoule, which fuses with cytoplasmic membrane and ruptures to throw the excreta.</span>
7 0
3 years ago
What is 120*566= just helppp
kiruha [24]
67920 I and hoping * means multiplying
7 0
3 years ago
Read 2 more answers
Describe the function of the structure pictured below. Fungus
Reptile [31]
Fungi are responsible for breaking down organic matter and releasing carbon, oxygen, nitrogen, and phosphorus into the soil and the atmosphere
3 0
3 years ago
The connective tissue that surrounds a muscle
Sati [7]

Answer:

hii

Explanation:

epimysium

Each muscle is surrounded by a connective tissue sheath called the epimysium. Fascia, connective tissue outside the epimysium, surrounds and separates the muscles.

7 0
2 years ago
Other questions:
  • Describe the pathway of blood going to and coming from the lungs!
    13·2 answers
  • What did edison learn from his attempts to see his first patented invention
    12·1 answer
  • In pea plants, purple flowers (P) are dominant over white flowers (p). If two heterozygous purple-flowered plants are crossed wi
    10·2 answers
  • What does the formula for table salt indicate about that compound?
    10·1 answer
  • Which would most affect the health of fish in a local pond?
    11·1 answer
  • Glucose-6-phosphate dehydrogenase deficiency (G6PD) is inherited as an X-linked recessive allele in humans. A woman whose father
    14·1 answer
  • Where does competition for reproduction mostly likely occur
    15·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • An animal that has thick fur, webbed flippers and blubber to keep it warm would probably live in which of the following biomes:
    13·2 answers
  • What is most likely to occur if different plant species compete for the same
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!