1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Evgesh-ka [11]
3 years ago
6

'erms: DNA, budding, male and female, one parent, unique, spores, uniform, traits, egg, and

Biology
1 answer:
fenix001 [56]3 years ago
8 0

Answer:

Asexual Reproduction

You might be interested in
Identify two ways in which you
Mars2501 [29]
Idk what this means sorry
6 0
3 years ago
Read 2 more answers
Which tissue forms coverings, linings, and glands
Vedmedyk [2.9K]
I believe it is Epithelial Tissue. <span />
4 0
3 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
PLZ HELP me...im struggling
PIT_PIT [208]
If D is dominant and d is recessive

1. Dd
2. DD
3. dd
4 0
3 years ago
What part of the plant is found at the tip of the pistil and receives pollen?
Murljashka [212]

Answer:

Your answer is Stigma.

Explanation:

The stigma is the sticky knob at the top of the pistil. It is attached to the long, tubelike structure called the style. Hope this helped :)

6 0
2 years ago
Read 2 more answers
Other questions:
  • The walking catfish, or Clarias batrachus, is an invasive species that can migrate over land. Which of the following describes t
    15·2 answers
  • _____ traits are to allport as _____ traits are to cattell
    11·1 answer
  • Summary of weathering , erosion , and deposition
    14·1 answer
  • Technician a says oily residue on hoses, components, or fittings indicates an area where refrigerant may be leaking. technician
    13·1 answer
  • gets BRAINILIST pls help need major help litarlly crying for help pls help me pls It question 11 of critical thinking 6th of 1.1
    9·1 answer
  • in an experiment on the traffic 20 cars are observed driving down the street in 4 hours what rate of traffic was observed in thi
    9·2 answers
  • What is a dependent variable
    12·2 answers
  • What is the difference between an every day question and a<br> scientific question?
    7·1 answer
  • Where are the proteins for a cell made?<br> mitochondria<br> cytoplasm<br> nucleus<br> ribosomes
    6·2 answers
  • What are three ways that pedigrees are beneficial?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!