1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
quester [9]
3 years ago
13

What are the 3 different shapes, or structures, or carbon base molecules?

Biology
1 answer:
ddd [48]3 years ago
3 0

Answer:

Carbon based molecules have 3 main structures which are

straight chain

branched chains

rings

Explanation:

The structure or shape of carbon can be a straight chain, branched chained or in the form of rings. Examples of straight chain carbon includes propane, butane and pentane. Examples of branched chain carbons include members of the alkyl group like methyl and ethyl. Ring shaped carbons form structures in the form of rings like benzene which forms a six carbon ring. All these structures are made and dependent on the ability of carbon molecules to form four covalent bonds. Enormous, complex molecules can be formed by the binding of carbon chains to carbon rings. The carbon based molecules are very important as they are the basic buiilding blocks of life. Many important molecule like the DNA, RNA, lipids are made up of carbon atoms.

You might be interested in
Stem cells in plants are referred to as?
Amanda [17]
The answer is B




Hope this helps
7 0
3 years ago
Some microorganisms can live in the intestines of termites. The termites eat wood, which the microorganisms break down into nutr
marishachu [46]

Answer:

it is a commensalism symbiosis

where the termites benefits from the wood and the microorganism benefits also and also unaffected

3 0
3 years ago
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
A simple _____ telescope uses two convex lenses to gather and focus light.
labwork [276]
A simple <em><u>refracting</u></em> telescope uses two convex lenses to gather and focus light from a distant object.
4 0
3 years ago
The process of isotopes breaking down and emitting particles, such as alpha or beta, to form a new substance
Sever21 [200]
It is radioactive decay
6 0
3 years ago
Read 2 more answers
Other questions:
  • Which scientists theories were closest to those of Darwin and his theory of evolution?
    15·2 answers
  • The steps in the melting of an ice-cream bar kept beside a bonfire are listed below:
    15·2 answers
  • this term describes the loss of electrons that occurs during metabolism, the process by which your body breaks down and builds u
    7·1 answer
  • What is the opposite of evaporation? How do these processes differ?
    6·2 answers
  • {10points} What did people invented using anatomy of frog?
    5·1 answer
  • Which statement describes what occurs in both animal and plant cells?
    8·1 answer
  • Climates are described using familiar elements of the weather. Which two of these elements are commonly found in the description
    12·1 answer
  • What vibrates as an electromagnetic wave passes by?
    10·1 answer
  • Why is iodine called an indicator
    5·1 answer
  • Hese single-celled organisms can be pathogenic but some can also be edible. a. bacteria b. viruses c. protozoa
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!