Explanation:
ATP is the short form of Adenosine Triphosphate. The molecule is made up of three basic things:
- Adenine ring
- Ribose sugar
- Three phosphate groups(triphosphate)
This molecule is provides the energy needed for life processes when broken down.
The elements that makes up ATP are:
- Carbon(C)
- Hydrogen(H)
- Nitrogen(N)
- Oxygen(O)
- Phosphorus(P)
Learn more:
ATP brainly.com/question/4957918
#learnwithBrainly
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Hydrogen atoms and one oxegyn atom
1st one, fats/phospholipids/steroids.
2nd one, cholesterol and saturated fats.