1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wolverine [178]
3 years ago
14

Give the formula or name for the following binary acids:

Chemistry
1 answer:
ICE Princess25 [194]3 years ago
8 0

Answer:

Formula and name of the binary acids.

Hydrochloric acid - HCl - Hydrogen chloride

Hydrobromic aci - HBr - Hydrogen bromide.

Explanation:

A substance which produces hydronium ions into water called binary acids.

most of the acids contain hydrogen in their chemical formula.

A binary acid composed of a hydrogen cation bonded to the one other element.

For example, HCl,HF and HI

The name and formula of the given binary acids is as follows.

Hydrochloric acid - HCl - Hydrogen chloride

Hydrobromic aci - HBr - Hydrogen bromide.

You might be interested in
Convert 0.00590 lb/qt to g/gal<br><br> Please help me i will mark the brainliest!!
Dima020 [189]
According to google, one gallon equals 8.36 pounds. I took 8.36and divided by 0.00590 and got 1416.94915254 So if rounded to the nearest hundreth, 1416.95. I have no idea if I'm right. Sorry I couldn't do more!
8 0
3 years ago
Magnesium hydroxide, the active ingredient in milk of magnesia, neutralizes stomach acid, primarily hcl, according to the reacti
Tema [17]
For every 1 molecule of Magnesium hydroxide or Mg(OH)2 there will be 2 molecules of HCl neutralized.
If molar mass of magnesium hydroxide is 58.3197g/mol, the amount of mol in 5.50 g magnesium hydroxide should be: 5.50g/ (<span>58.3197g/mol)= 0.0943mol.
Then, the amount of HCl molecule neutralized would be: 2* </span>0.0943mol= 0.18861 mol

If molar mass of HCl is 36.46094 g/mol, the mass of the molecule would be: 0.18861 mol* 36.46094g/mol = 6.88grams
5 0
3 years ago
Read 2 more answers
2. How many grams of water can be heated from 20.0 oC to 75oC using 12500.0 Joules?
kenny6666 [7]

Answer;

  = 0.054 kg or 54 g

Explanation;

Using the equation; Q = mcΔT where Q is the quantity of heat transferred, m is the mass, c is specific heat of the substance, ΔT is delta T, the change in temperature.  

ΔT = 75 - 20 = 55 C.  

Solve the equation for m  

m = Q/ cΔT

Mass = 12500 / (55 × 4200)

        = 0.054 kg or 54 g


4 0
3 years ago
Read 2 more answers
Define physical change and give an example
Musya8 [376]
Physical isn't so chemical

6 0
3 years ago
Read 2 more answers
Enter your answer in the provided box.
Lina20 [59]

Answer:

5.06atm

Explanation:

Using the combined gas law equation;

P1V1/T1 = P2V2/T2

Where;

P1 = initial pressure (atm)

P2 = final pressure (atm)

V1 = initial volume (Litres)

V2 = final volume (Litres)

T1 = initial temperature (K)

T2 = final temperature (K)

According to the information provided in this question;

P1 = 1.34 atm

P2 = ?

V1 = 5.48 L

V2 = 1.32 L

T1 = 61 °C = 61 + 273 = 334K

T2 = 31 °C = 31 + 273 = 304K

Using P1V1/T1 = P2V2/T2

1.34 × 5.48/334 = P2 × 1.32/304

7.34/334 = 1.32P2/304

Cross multiply

334 × 1.32P2 = 304 × 7.34

440.88P2 = 2231.36

P2 = 2231.36/440.88

P2 = 5.06

The final pressure is 5.06atm

6 0
3 years ago
Other questions:
  • The chemical equation given below represents the chemical reaction between lithium (Li) and sulfur (S). In the equation, why is
    13·2 answers
  • A parchment fragment was discovered that had about 68% as much 14C radioactivity as does plant material on Earth today. Estimate
    6·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Sodium permanganate and iron(III) chloride are both dissolved in a beaker of water. In a double displacement reaction, two new p
    13·1 answer
  • H20 (water) indicates there are _____.
    7·1 answer
  • In an experiment Nyla collected the following information about a solution made from a certain food:
    14·1 answer
  • Calculate the mass of each element in the compound by multiplying its molar mass
    6·1 answer
  • The electron configuration of vanadium (III)ion is:
    11·2 answers
  • 
    15·2 answers
  • HELP ITS DUE IN 5 MINS PLSSS Name at least one negative affect that is the result of clearing areas of a rainforest.
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!