Answer:
Letter C
Explanation:
Salmon have a physiological adaptation that allows osmoregulation to occur in two different environments (seawater and freshwater). There are specific molecules in the salmon gills that "pump" and "remove" Na and Cl ions. When at sea these molecules pump the ions out of the salmon's body and into freshwater, the same molecules remove Na and Cl from the water bringing it into the animal's blood.
Asexual reproduction because cells divide through the process of meiosis which sexual reproduction.
Answer: d- because a model is never exactly the same as the thing it represents
Answer:
a.Many mitochondrial genes resemble proteobacteria genes, while the genes in the chloroplast resemble genes found in some photosynthetic bacteria.
c.Mitochondria and chloroplasts both have their own circular DNA and 70S ribosomes that are similar to those found in bacteria.
d.Mitochondria and chloroplasts replicate by a process similar to mitosis.
Explanation:
Endosymbiotic theory states that mitochondria and chloroplast which are organelles of eukaryotic cells were once independently living micro-organisms but with due course of time eukaryotic cells engulfed them and they become an integral part of these eukaryotic cells.
The resemblance between mitochondrial genes with those of proteobacteria and chloroplast genes with photosynthetic bacteria strongly support endosymbiotic theory. Apart from this, the presence of their own DNA that too circular just like prokaryotic microbes and 70 S ribosomes also support this theory. Also just like prokaryotic cells, before cell division mitochondria and chloroplasts undergo replication by means of a process known as binary fission.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
