1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tpy6a [65]
3 years ago
13

Some protists can reproduce both sexually and asexually. What's a major advantage of each?

Biology
2 answers:
Neporo4naja [7]3 years ago
6 0

Answer:

(A). Sexual reproduction increases genetic diversity, and asexual reproduction can be more rapid.

Explanation:

Sexual reproduction is a mode of reproduction, which involves formation of new organisms by combination of genetic information from two organisms of different sexes. The major advantage of sexual reproduction is to develop genetic diversity as new organism is produced by mixing up genetic material of both the parents.

On the other hand, asexual reproduction involves formation of new organisms from a single parent having identical genetic makeup as present in parent cell.  One of the major advantage of asexual reproduction is to produce high number of offspring in less time as it is more rapid than sexual reproduction.

Thus, the correct answer is option (A).

n200080 [17]3 years ago
4 0

Answer:

A. Sexual reproduction increases genetic diversity, and asexual reproduction can be more rapid.

Explanation:

You might be interested in
When in solution, a molecule that moves slowly across an artificial membrane moves rapidly across a plasma membrane. This molecu
labwork [276]

Answer:

b. active transport

Explanation:

Active transport -

It is the movement of the molecules across the membrane via a region of lower concentration towards the region of higher concentration , and in some cases , the flow is independent of the concentration .Its is known as active transport .

This process needs some amount of energy in the form of cellular energy .

Hence , the correct term for the given statement is active transport .

5 0
3 years ago
Fill in the blank. Growth and repair in multicellular organisms are the result of _______________.
Kryger [21]
The answer is A. Excretion I hope this helps
8 0
3 years ago
How does salt-induced land degradation occur?<br> NEED ASAP<br> WILL MARK BRAINLIEST
yulyashka [42]

Answer:

Salt-induced land degradation occurs in regions where there rainfall is too low to maintain of water to go into the soil.

Explanation:

Tell me if I'm right pls

3 0
3 years ago
Are crayfish arthropods?
Bezzdna [24]

Answer:No

Explanation:

Because they are closely related to the lobster

4 0
3 years ago
Read 2 more answers
Which predator is typically found in Central Africa (but occasionally at geocode 34.043021, -118.2668356) and slays its opponent
aleksklad [387]
The answer is a black mamba.

The black mamba is predator typically found in central Africa. Not only that its scales are black but also an interior of its mouth. It moves very quickly and at any sudden movement, it is ready to slay its opponents through a rapid application of venomous strikes. <span>Its venom is highly toxic and it could kill a man for 10-15 hours after the bite if antivenom is not applied.</span>
8 0
3 years ago
Other questions:
  • 1. Diabetes is a disease where the body is unable to produce enough insulin in the pancreas to help lower the levels of blood gl
    14·1 answer
  • Why are sex-linked traits more common in males than in females?
    11·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • DNA is a polymer consisting of monomers know as
    7·1 answer
  • The minimum amount of stimulus for an action potential to occur is
    15·1 answer
  • In intramembranous ossification, newly formed bone that is immature and not well organized is called ______.
    8·1 answer
  • Why is the media we use to grow bacteria get damaged?​
    6·1 answer
  • To study mitosis, a student places a garlic clove in water. After five days, the student observes roots growing from the clove.
    8·2 answers
  • Describe the route taken by oxygenated blood from the lungs to the body cells
    6·1 answer
  • In the phenomenon of binocular rivalry, when one eye sees one pattern and the other eye sees another, what do you perceive?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!