1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergeeva-Olga [200]
3 years ago
6

PLEASE HELP! Question in picture below!

Mathematics
1 answer:
qaws [65]3 years ago
6 0

Answer:

x = 13/8

Step-by-step explanation:

sqrt(8x-4) +8 = 11

Subtract 8 from each side

sqrt(8x-4) +8-8 = 11-8

sqrt(8x-4) =3

Square each side

(sqrt(8x-4))^2 =3^2

8x-4 = 9

Add 4 to each side

8x-4+4 = 9+4

8x = 13

Divide by 8

8x/8 = 13/8

x = 13/8

You might be interested in
4 Ayla s is paid $15 20 per hour for a 34 hour week. April has the same weekly pay but works 38
VashaNatasha [74]

Find Atlas weekly pay by multiplying rate by hours:

15.20 x 34 = 516.80 a week.

Now to find Apri’s rate divide the weekly pay by hours:

516.80 / 38 =$13.60 per hour

5 0
3 years ago
Given: f(x)=x^2, g(x)=x+6, h(x)=7<br><br>Find h{g[f(x)]}​
arsen [322]

Step-by-step explanation:

f(x)=x^2,\ g(x)=x+6,\ h(x)=7\\\\h(x)=7\ \text{It's the constant function. Therefore}\ h\{g[f(x)]\}=7

4 0
4 years ago
Write your question here keep it simple and clear
igor_vitrenko [27]

。☆✼★ ━━━━━━━━━━━━━━  ☾  

12 + 12 + 18 + 18 = 60

The perimeter is 60 cm

Have A Nice Day ❤    

Stay Brainly! ヅ    

- Ally ✧    

。☆✼★ ━━━━━━━━━━━━━━  ☾

7 0
3 years ago
WILL GIVE BRAINLIEST AND 20 POINTS
otez555 [7]

Answer:

34 is the angle in the top left       87 is the angle on the top right ans 59 is the angle on the bottom right

Step-by-step explanation:

4 0
3 years ago
Read 2 more answers
Which of the following is the solution of –6x – 17 = 19?
natita [175]

   -6x - 36  =   -6 • (x + 6) 

                   x = -6
<span>
</span>

6 0
3 years ago
Read 2 more answers
Other questions:
  • Please help with math !!!!
    8·1 answer
  • What are the factors of 49x^6?
    14·1 answer
  • List the measurements below from from smallest to largest. 7cm 18mm 1m 3dm
    10·1 answer
  • What is the volume of the prism
    11·1 answer
  • Which point is an x-intercept of the quadratic function
    14·2 answers
  • An exam has two probability problems, 1 and 2. If 37% of the students solved problem 1 and 12% of the students solved both probl
    15·1 answer
  • If a figure located at T(-3, -1), U(1, -2), V(2, 2), W(-1, 1) and is rotated 90∘ counterclockwise rotation about the origin, whi
    9·1 answer
  • NEED HELP PLEASEEE!!!!
    7·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Tom bought a radio on sale for 20% off for $68. What was the original<br> cost of the radio?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!