Explanation:
The mass of an object is a measure of the object's inertial property, or the amount of matter it contains. The weight of an object is a measure of the force exerted on the object by gravity, or the force needed to support it. The pull of gravity on the earth gives an object a downward acceleration of about 9.8 m/s2.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
The metal properties that make up electrical wires are conductivity and ductility. Conductivity is important for free electrons to flow, hence electricity. Ductility is as well integral for strips to be formed, but with ample strength that does not break the material.
Answer:
Ionic Compounds have high boiling and melting points as they're very strong and require a lot of energy to break. The electrostatic forces of attraction between oppositely charged ions lead to the formation of ions. Ionic compounds form crystals. These compounds are brittle and break into small pieces easily.
Explanation:
Answer:asexual- Energy is not required to find a mate. Offspring are genetic clones. A negative mutation can make asexually produced organisms susceptible to disease and can destroy large numbers of offspring. Some methods of asexual reproduction produce offspring that are close together and compete for food and space.
Explanation:During sexual reproduction the genetic material of two individuals is combined to produce genetically diverse offspring that differ from their parents.
