1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
saw5 [17]
3 years ago
15

Describe DNA’s important genetic role in a few sentences below.

Biology
2 answers:
Westkost [7]3 years ago
7 0
Its what makes you well you dna comes form your parents 
Ber [7]3 years ago
3 0
There r 4 types of nytrogen bases adenine ,thymine, guanine, and cytosine
its role is making who u r as a living pearson
You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Three characteristics of enzymes​
choli [55]
1)Enzyme is a protein. The main material of an enzyme is protein
2)It is easily influenced, by environmental change. Environmental factors include temperature, pH, and inhibitor.
3)It acts as catalyst The enzyme functions in accelerating chemical reaction, but the enzyme itself does not change after the reaction ends.
6 0
2 years ago
Read 2 more answers
sun, salmon, maple trees, bears, plankton, whales, grass, cows, humans, shrimp, caterpillars, finches (small birds), hawks
Iteru [2.4K]
Yes, they are all living things that exist in our world. 
6 0
2 years ago
Which correctly identifies the location of the asteroid belt?
Fittoniya [83]

Answer: The correct answer would be B

7 0
2 years ago
Read 2 more answers
______ means that the two members of the allele pair are the same.
Mama L [17]

Answer: A because two of the same pairs are homologous

4 0
2 years ago
Read 2 more answers
Other questions:
  • 8. A stroke is a sudden loss of brain function. It results from a lack of gas exchange with brain tissue, which occurs when the
    12·1 answer
  • A tiny rocky island in the South Pacific is home to a very small food chain. Coconut palms grow on the island and drop coconuts.
    9·1 answer
  • Which helps prevent errors in DNA replication
    5·2 answers
  • What is a food chain/6067896/d633c784?utm_source=registration
    10·1 answer
  • What is the scientific name for a robin ?
    9·1 answer
  • Suppose that a dominant allele (P) codes for a polka-dot tail and a recessive allele (p) codes for a solid colored tail. In addi
    6·1 answer
  • The beginning of the Cretaceous period is marked by the emergence of dinosaurs in the fossil record.
    5·2 answers
  • I NEED HELP ASAP!!! Plato
    7·1 answer
  • A study is being done to test the effects of habitat space on the size of fish populations. Different sized aquariums are set up
    12·1 answer
  • Which of the following is a characteristic of invasive species?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!