1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MatroZZZ [7]
2 years ago
5

Which flow chart correctly organizes the structures of heredity, from least to most complex?

Biology
2 answers:
juin [17]2 years ago
8 0

Answer:

codon → gene → DNA → chromosome

Explanation:

  • Codon describes 3 bases (letters) of DNA
  • A gene describes a segment of DNA that usually encodes for a particular protein
  • A chromosome is a molecule of DNA (hundreds or thousands of genes) compacted and complexed with proteins

jenyasd209 [6]2 years ago
4 0

Answer:

A

Explanation:

The man said it himself

You might be interested in
Yeast is a part of the group
inysia [295]
Well I guess it is then
3 0
2 years ago
What is an argument in favor of using embryonic stem cells over adult stem cells?
devlian [24]

Answer:A

Explanation:

The ES cells is pluripotent, and the adult stem cell is unipotent.

5 0
3 years ago
What type of map is shown in the diagram?
Dennis_Churaev [7]

Answer:

topographic map

Explanation:

As shown in my picture it seems pretty similar

4 0
3 years ago
Read 2 more answers
Which is true of genes found on chromosomes?
PSYCHO15rus [73]
The option that is true of genes found on chromosomes is that D. they determine the inherited traits of an organism.
Genes are inherited - so those are the things that we get from our parents and other ancestors. It is easy to determine which of these genes a child is going to inherit - the doctors just need to take a look at the chromosomes, because genes are located there.
4 0
3 years ago
Read 2 more answers
Which process would be used during the healing process of a paper cut? mitosis, meiosis or differentation
vichka [17]
I believe that is meiosis. If I am not right then search for it online

: )
7 0
2 years ago
Other questions:
  • What is not a benefit of breathing through the nose?
    10·1 answer
  • Explain how the lungs and circulatory system work together?
    12·2 answers
  • If the pressure, volume, and the number of moles of a gas are known, which is needed to calculate the universal gas constant
    8·1 answer
  • When will heat flow between two objects?
    8·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Why fluids can flow while solids cannot (particle theroy)
    9·2 answers
  • Which of the following can microorganisms do when living on or inside a larger organism's body?
    9·1 answer
  • What is digestion?
    5·2 answers
  • All cells in your body need a constant supply of energy to stay alive.
    9·1 answer
  • Which of the following food groups does the food produced belong?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!