1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
seraphim [82]
3 years ago
10

How far apart must two point charges of 75.0 nC (typical of static electricity) be to have a force of 1.00 N between them? (answ

er in mm)
Chemistry
1 answer:
Jet001 [13]3 years ago
3 0

Answer:

7.12 mm

Explanation:

From coulomb's law,

F = kqq'/r².................... Equation 1

Where F = force, k = proportionality constant, q and q' = The two point charges, r = distance between the two charges.

Make r the subject of the equation,

r = √(kqq'/F).......................... Equation 2

Given: q = q' = 75.0 nC = 75×10⁻⁹ C, F = 1.00 N

Constant: k = 9.0×10⁹ Nm²/C².

Substitute into equation 2

r = √[ (75×10⁻⁹ )²9.0×10⁹/1]

r = 75×10⁻⁹.√(9.0×10⁹)

r = (75×10⁻⁹)(9.49×10⁴)

r = 711.75×10⁻⁵

r = 7.12×10⁻³ m

r = 7.12 mm

Hence the distance between the point charge = 7.12 mm

You might be interested in
The ___ blends into outer space.
Paraphin [41]

Answer:

Exosphere

Explanation:

it is found at the end reaching outer space

3 0
2 years ago
How many molecules are present in 4.21 moles of HBr?​
salantis [7]

Answer:

The answer is

<h3>2.53 × 10²⁴ molecules</h3>

Explanation:

The number of molecules present can be found by using the formula

<h3>N = n × L</h3>

where n is the number of moles

N is the number of entities

L is the Avogadro's constant which is

6.02 × 10²³ entities

From the question we have

N = 4.21 × 6.02 × 10²³

We have the final answer as

<h3>2.53 × 10²⁴ molecules</h3>

Hope this helps you

6 0
3 years ago
List a mixture that can be separated by fractional distillation
vivado [14]
Separation of components of crude oil
5 0
2 years ago
What the answer question
Serga [27]

Answer:

it's a trigonal bipyramidial

Explanation:

because NH3 have 3 hydrogen atoms

4 0
2 years ago
A barrel of water weighs 60 pounds. What must you put in it for it to weigh 40 pounds?
astraxan [27]

Answer:

A hole

Explanation:

put a hole in the barrel and let some water out

3 0
3 years ago
Read 2 more answers
Other questions:
  • 20 N force moving a box to 30 meters distance. How much work id done? if it takes 10 sec to do this work, how much power is used
    5·1 answer
  • Which statement best describes gravity? (3 points)
    12·2 answers
  • Do you think that scientists should continue to try to create super-heavy elements and expand the periodic table? Explain why or
    11·2 answers
  • 2. What happens to the pH when you add more H+ ions to a solution that has no buffers?
    15·1 answer
  • When Philip analyzed unknown substance x, he found that it contained only one kind of atom what is substance x
    12·1 answer
  • compound of aspartame is a dipeptide that is often used as a sugar substitute which functional groups are present
    11·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Please help thank you (15 points)
    8·1 answer
  • Activity 2 Directions: Select among the choices thbest type of material to be used in making the objects at the left and explain
    15·1 answer
  • How much energy would be released as an electron moved from the n=4 to the n=3 energy level?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!