1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
My name is Ann [436]
4 years ago
14

The stock solution of hydrochloric acid is 12.0M HCI. If the teacher starts with 130 ml of this concentrated acid, what volume o

f 3.0M HCI can be prepared?
Chemistry
1 answer:
tatyana61 [14]4 years ago
6 0

Answer:

520mL

Explanation:

Data obtained from the question include:

Molarity of stock solution (M1) = 12M

Volume of stock solution (V1) = 130mL

Molarity of diluted solution (M2) = 3M

Volume of diluted (V2) =..?

The volume of the diluted solution can be obtained as follow:

M1V1 = M2V2

12 x 130 = 3 x V2

Divide both side by 3

V2 = 12 x 130 / 3

V2 = 520mL.

Therefore, 520mL of the diluted solution can be prepared.

You might be interested in
Convert 27.7 kilometers to centimeters.
Stolb23 [73]

Answer:

The correct answer is - 2770000 cm.

Explanation:

1 kilometer = 1000 meter

1 meter = 100 centimeter

1 kilometer = 100*1000 cm

1 km = 100000 cm.

then,

27.7 kilometers = 2.77 × 10^6 centimeters

So, 27.7 kilometers = 27.7 × 100000

= 2.77 × 106 or 2770000 centimeters.

7 0
3 years ago
Stuck stupid science homework. anyone know answers?
Veronika [31]
The charge of a Rb ion would be +1
7 0
3 years ago
What do the elements within a "period" have in common? (pick one)
Gnesinka [82]

Answer:

All of the elements in a period have the same number of atomic orbitals. For example, every element in the top row (the first period) has one orbital for its electrons. All of the elements in the second row (the second period) have two orbitals for their electrons.

Explanation:

6 0
3 years ago
Read 2 more answers
nuclear energy is created through the process of splitting apart atoms and releasing large amounts of heat energy that can be co
shutvik [7]
Nuclear fission is a process by which the nucleus of an atom is split into two or more smaller nuclei, known as fission products. The fission of heavy elements is an exothermic reaction, and huge amounts of energy are released in the process.
3 0
3 years ago
16.0 grams of molecular oxygen gas is equal to
IceJOKER [234]

One thing to notice in the question is, we are asked about molecular oxygen that has formula O2 not atomic oxygen O.

As we are asked about molecular oxygen, we will answer the question in terms of number of molecules that are present in 16 grams of molecular oxygen.

To get the number of molecules present in 16 grams of O2, we will use the formula:

         No. of molecules = no. of moles x Avogadro's number (NA)-----  eq 1)

As we know:

                        The number of moles = mass/ molar mass of molecule

Here we have been given mass already, 16 grams and the molar mass of O2 is 32 grams.

Putting the values in above formula:

                                                    = 16/32  

                                                     = 0.5 moles

Putting the number of moles and Avogadro's number (6.02 * 10^23) in eq 1

                                No. of molecules = 0.5  x 6.02 * 10^23

                                   =3.01 x 10^23 molecules

or                 301,000,000,000,000,000,000,000 molecules

This means that 16 grams of 3.01 x 10^23 molecules of oxygen.

Hope it helps!

4 0
3 years ago
Read 2 more answers
Other questions:
  • What is the simplest formula for Sr4S4?
    12·1 answer
  • An aqueous solution of iron(II) sulfate (FeSO4) is prepared by dissolving 2.00 g in sufficient deionized water to form a 200.00
    12·1 answer
  • How can you tell that a compound contains an ionic bond
    6·1 answer
  • Helpppppppppppppppppppppppppppppppppp
    11·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Which of the following elements has the smallest atomic radius
    5·1 answer
  • What do neurons and protons have in common?
    13·2 answers
  • Which substance is an example of a colloid?
    13·1 answer
  • Which electromagnetic waves are used in ovens and cell phone communications
    8·2 answers
  • Helpppp ppleaseeee ill mark you as brainlister
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!