1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elena55 [62]
2 years ago
10

A series of chemical reactions that produces sugars from carbon dioxide

Biology
2 answers:
denis23 [38]2 years ago
3 0
The Calvin Cycle, its final product is glucose
SOVA2 [1]2 years ago
3 0
It's photosynthesis.
You might be interested in
What makes the ore bauxite special
wel
Bauxite does not have a specific composition. it's a mixture of hydrous aluminum oxides, aluminum hydroxides, clay materials, and insoluble materials such as, quartz, hematite, magnetite, siderite, and goethite
6 0
3 years ago
Read 2 more answers
Why does the sodium potassium pump require ATP?
SpyIntel [72]

Answer:

The sodium–potassium pump is found in many cell (plasma) membranes. Powered by ATP, the pump moves sodium and potassium ions in opposite directions, each against its concentration gradient. In a single cycle of the pump, three sodium ions are extruded from and two potassium ions are imported into the cell.

Explanation:

Hope I helped!

5 0
3 years ago
Which organelle is labeled G?
lilavasa [31]

Answer:

Plasma membrane

Explanation:

5 0
2 years ago
True or False?<br> Only a living organism exhibits all of the characteristics of life.
IrinaK [193]
I would say its true. Does inanimate objects do life like things? 

4 0
3 years ago
Read 2 more answers
Drag the tiles to the correct boxes to complete the pairs.
Digiron [165]

Pre-modern-high birth rate and death rate

Mature industrial-low birth rates, death rates are constant

Industrialization-high birth rate and low death rate

6 0
3 years ago
Other questions:
  • 7. Mucus traps germs and dust. *<br> True or false
    13·2 answers
  • Unlike the methods of early scientists, how did Sir Francis Bacon believe basic laws of science should be determined?
    11·2 answers
  • What describes the long history or Earth.
    9·2 answers
  • Two or more atoms held together in molecules by relatively strong forces called
    12·2 answers
  • Animals store carbohydrates in the form of
    8·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Question 4<br> RNA is<br> double-stranded<br> single-stranded<br> twisted-ladder<br> Previous
    7·1 answer
  • What are Stem cells found in adult tissue, such as in the bone marrow, brain, muscle , skin , and liver only capable of ?
    11·1 answer
  • Chemical processes that involve one or more chemical reactions keep living things alive. Which of these types of chemical reacti
    7·1 answer
  • The Electromagnetic Spectrum ONLY has which shape of wave?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!