1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PSYCHO15rus [73]
3 years ago
12

Nearly all plants can be reproduced asexually.

Biology
1 answer:
Minchanka [31]3 years ago
5 0
The first question is B. false, The answer to the second question is stolon.
You might be interested in
What would happen if the number of plants in a room where increases from 20 plants to 100 plants?
Nadya [2.5K]
I think you’ll be able to be able to breathe better
8 0
4 years ago
What is the indicator we are using in this titration? In your own words, what is the purpose of grinding the spirulina? Should t
AveGali [126]

Answer:

What is the indicator we are using in this titration?

a deep blue indicator

Explanation:

What is the indicator we are using in this titration?

a deep blue indicator

the purpose of grinding the spirulina is to be able to break the cell into smaller particles that can dissolve well in a solution.

when powder spirulina is mixed with silica the cells are easily break even.

Should the ground silica and spirulina mixture be suspended in deionized water, exhibit water, or buffer? Why?

ground silica and spirulina mixture be suspended in deionized water because its dissolved and mixed well in water than any other solvent.

What is the color of the folded phytobilliprotein with the bound cofactor?

A blue color is observed when phytobilliprotein is folded.

How do you expect it to change as you add acid or base?

when a base solvent is use for the solution of silica and spirulina (e.g of base NaOH) is used, the colour obseved will be pale yellow or green color.

when a acidic solvent is use for the solution of silica and spirulina (e.g of base HCL) is used, the colour obseved will be colorless solution.

When a base and acidic solvent is used, it causes a changed in the charge state of the protein and changes the interaction thereby causing unfolding.

5 0
3 years ago
A substance, such as auxin, that is produced by a plant and affects how the plant grows and develops is best called
QveST [7]
The answer is Hormone
8 0
4 years ago
Read 2 more answers
100 POINTS
Finger [1]

The trait is passed on genetically to the next generation

Explanation:

4 0
3 years ago
Need help here is the ss
vladimir1956 [14]
There are omnivores, carnivores, herbivores, and decomposes. Omnivores eat both plants and animals, carnivores eat animals, herbivores eat plants, and decomposers feed on dead material.
5 0
3 years ago
Read 2 more answers
Other questions:
  • what would be most likely to happen to a plant that had working chloroplasts and its cells but had taken and poison that kept th
    7·1 answer
  • An ecosystem includes... A. only the non-living parts of the community. B. only the living members of the community. C. both the
    8·2 answers
  • Please Helppp!!! 100 points ASAP
    6·2 answers
  • Suppose you are involved in a project studying a population of Dalea purpurea (purple prairie clover), a diploid, bee pollinated
    12·1 answer
  • Which statements describe adaptations necessary for plants to live on land? Check all that apply.
    6·1 answer
  • In rabbits, short hair(S) is dominant over long hair(s). What genotype and phenotype ratios are expected from a cross between tw
    7·2 answers
  • List and describe three factors that affect how quickly enzymes can work to catalyze reactions
    6·1 answer
  • PLEASE HELP ASAP 20 POINTS PLUS BRAINLIEST
    12·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Producers use energy from the Sun to create ___________, or usable chemical energy.
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!