1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Akimi4 [234]
3 years ago
12

In the classification of living organisms, which of the following is an example of a domain?

Biology
1 answer:
cupoosta [38]3 years ago
6 0

Answer:

it's BACTERIA

Explanation:

There are three widely recognized domains: Archaea, Bacteria, and Eukarya. Viruses lack many traits of living things so the majority of scientists do not classify them as living organisms.

You might be interested in
Which part of a seed plant develops into sprem cells?
bekas [8.4K]
Sperm cells inside the pollen grain travel down the pollen tube and into the ovary which contains the ovules. Fertilization occurs when one of the sperm cells fuses with the egg inside of an ovule
4 0
2 years ago
Which of the following is true about ischemic stroke? a. Often caused by emboli from the basilar arteries b. Has risk factors th
sleet_krkn [62]

Answer: Option B.

Has risk factors that include atherosclerosis

Explanation:

Ishchemic stroke has a risk factor that include Atherosclerosis because it is when blood clot causes a blockage to artery that supplies blood to the brain.

This is major caused by buildup of plagues or deposition of cholesterol ( atherosclerosis). The blockage reduces the blood flow and oxygen to the brain, which cause damage or death of brain cells

If the arteries become too narrow, blood cells may collect and form blood clots.

4 0
3 years ago
The amount of matter that cycles through a food web
kari74 [83]

the correct answer is A

3 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
In an experiment to test a new drug’s effectiveness, one group is given a larger dosage than is typically prescribed, and a seco
Tom [10]
<span>One group is given a larger dosage than is typically prescribed.
A second group is given a smaller dosage than is typically prescribed
Then results of the groups are compared to each other.

The thing that is missing in this experimental design is a third group who are tested with the typical dosage.</span>
7 0
2 years ago
Other questions:
  • Description of proton
    7·1 answer
  • How does organismal behavior demonstrate an emergent property of an organism's physiology
    5·1 answer
  • PLEASE HELP!!
    10·1 answer
  • Do you see a connection between wavelength and frequency? Explain.
    6·1 answer
  • Study the illustration below of the plate tectonics affecting the continent of Africa. Divergent plates are causing the East Afr
    10·1 answer
  • When the M phase begins during the cell cycle, it starts with____.
    9·2 answers
  • WILL MARK BRAINLIEST!!!!
    7·1 answer
  • According to fossil records, the horses that lived 50 million years ago were much smaller, weaker and slower than modern horses.
    7·1 answer
  • The nitrogen cycle describes how nitrogen is converted between different forms. Describe the nitrogen cycle process by completin
    14·1 answer
  • What are all living things made of?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!