1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Margaret [11]
3 years ago
10

What muscle is the woman using to lift the ball over her head

Biology
1 answer:
wolverine [178]3 years ago
8 0

Answer:

Deltoid

Explanation:

The muscles of the trunk and the muscles of the lower extremity will be used for stability and moving the box across the 2 meters. The muscles of the upper extremity would be used to varying degrees to lift, hold, and lift the box to sternum level and place it in its place and which muscles contribute to the specific portion of the task you intend to study will depend on the magnitude of the load, the frequency the task is completed, the velocity at which the task is completed, the height differential between where the box is lifted from to the height at which the box is placed when the task is completed.

You might be interested in
Spray drying is a process in which a liquid containing
Ad libitum [116K]
Spray drying is a process in which a liquid containing dissolved or suspended solids is sprayed through a nozzle into a chamber in which hot air is being blown into at the same time. As the nozzle releases small drops of the solution, it comes in contact with the hot air and the moisture content of each droplet is removed. This way, the liquid is turned to powder form which moves to a conveyor belt at the bottom of the chamber.





3 0
3 years ago
Match the following.
liraira [26]

Answer:

1) The stage of mitosis in which the chromosomes move to opposite ends of the cell. >>>> Anaphase

2) forms the ends of the spindle fibers in the cell during mitosis.

>>>>>Centriole.

3) part of a chromosome that attaches to the spindle apparatus during mitosis or meiosis. >>>>>Centromere

4) a structure that forms across the middle of a higher plant cell in telophase; the beginning of a new cell wall which divides the two daughter cells from one another to finish mitosis. >>>>>Cell plate.

5) material in the cell nucleus that carries hereditary information; made up of DNA and various kinds of protein. >>>>>Chromatin.

7 0
2 years ago
The two strands of a dna molecule are held together by hydrogen bonds between the
ZanzabumX [31]

the answer is bases.

6 0
3 years ago
What makes an allele dominant recessive or codominant
kati45 [8]
Dominant refers to the relationship between two versions of a gene. Individuals receive two versions of each gene, known as alleles, from each parent. If the alleles of a gene are different, one allele will be expressed; it is the dominant gene. The effect of the other allele, called recessive, is masked.
7 0
2 years ago
A hydrogen fuel cell is more efficient than a combustion reaction because very little of the released energy is released as ____
likoan [24]
<span>1. A hydrogen fuel cell is more efficient than a combustion reaction because very little of the released energy is released as HEAT. 

We need more energy emit as light and less heat. Lesser the heat more the efficiency.

2. </span>when used at home a fuel-cell illuminates the need for <span>an electrical grid</span> because the cell is portable.

As said, it is portable.
6 0
2 years ago
Read 2 more answers
Other questions:
  • An mRNA macromolecule transcribes genetic code from a DNA macromolecule in a cell's nucleus and carries the
    7·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which difference between water and ice results in ice floating on cold water?
    14·1 answer
  • The blank of animals is based on scientist current understanding of the evolutionary history of living species
    6·1 answer
  • What process is similar to binary fission
    14·1 answer
  • Stingrays and flounders, while not related, both have very flat <br> bodies.
    11·1 answer
  • What macromolecule is produced during photosynthesis for plant food?
    12·2 answers
  • How many CO2 molecules are produced when three glucose molecules undergo cellular respiration? Explan ​
    11·1 answer
  • Gregor Mendel's research consisted of using parent pea plants that were pure breeds. What genotype(s) would be considered pure b
    8·1 answer
  • Muscles break down glucose into lactate which undergoes glycolysis. the end product of glycolysis in active muscles is:_______
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!