1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
julia-pushkina [17]
3 years ago
11

Mitosis Results in 2 different cellsTrue Or False?​

Biology
1 answer:
nataly862011 [7]3 years ago
4 0

Answer:

True

Explanation:

I hope this helps you:)

You might be interested in
Which of the following are examples of what scientists can learn from studying fossils?
FrozenT [24]
The answer is a and c
7 0
2 years ago
Read 2 more answers
How do environmental scientists use technology to track polar bears?
sukhopar [10]

Answer:

Environmental Scientists can use GPS tagging

Explanation:

3 0
3 years ago
Read 2 more answers
Information from higher brain regions is transmitted to the medulla and cerebellum through the:________.
krek1111 [17]

Answer: Option D.

Thalamus.

Explanation:

It is thalamus because thalamus is a mass of grey matter structure in the brain that is located between the cerebral cortex and the midbrain which also have some nerves connected to them and it is responsible for sending motor and sensory signals to the cerebral cortex and also regulate conciousness and mental alertness.

It transmit information from the higher brain region to the medula and cerebellum.

6 0
3 years ago
If molecules move from one place to another inside of the so what type of mutation is this?
arsen [322]
It's called active transport.
7 0
3 years ago
Read 2 more answers
The diagram below shows the general structure of an amino acid. Which type of molecule is formed from amino acids?
andrey2020 [161]

Answer:

Proteins

Explanation:

Proteins are made up of many repeating units (monomers) of amino acids that are joined by peptide bonds.

Hope this helps :)

7 0
2 years ago
Other questions:
  • White blood cells can be found in what liquids?
    12·1 answer
  • Which of the following statements is true?
    6·1 answer
  • What is the difference between a vascular and a nonvascular plant? In your answer, discuss how water moves in each type of plant
    12·1 answer
  • Parasitism is when
    15·2 answers
  • Which is a cause of chemical weathering <br> A.gravity <br> B.acid <br> C.sunlight <br> D.wind
    10·2 answers
  • Which characteristics are used to classify stars on the Herzberg Russell diagram? Check all that apply
    6·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Why does your arm feel numb if you put too much pressure on it?
    6·1 answer
  • Help please I have no time
    6·2 answers
  • How many protons and electrons does Calcium have?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!