1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
julia-pushkina [17]
3 years ago
11

Mitosis Results in 2 different cellsTrue Or False?​

Biology
1 answer:
nataly862011 [7]3 years ago
4 0

Answer:

True

Explanation:

I hope this helps you:)

You might be interested in
Which is the correct breakdown and translation of the medical term vaginoperineotomy?
egoroff_w [7]
Hello!! I am going to break down the word first. Vagino means vagina, perineo means perineum (area between the anus and the scrotum), and tomy means to make an incision or cut. The translation would be to make an incision to repair a perineal tear (which means the vagina has separated from the anus). Perineal tears are usually caused by childbirth. I hope I helped and gave the answers you were looking for!! Have a great evening.
6 0
3 years ago
You are called for a​ 2-year-old boy who fell and cut his arm. while en route to the​ call, the dispatcher informs you that the
ICE Princess25 [194]
If a patient has hemophilia and has cut themselves, you need to realize that the bleeding may not stop for the entire transport and manual pressure may needed to be applied the entire time. You should start an IV on the patient and administer saline, depending on the amount of blood loss.
3 0
3 years ago
Air molecules move from areas of ____ pressure to areas of ______ pressure
Serggg [28]
High pressure to low pressre
5 0
3 years ago
Alfred Wegener was a meteorologist that had access to modern _____
marshall27 [118]

Answer:

Alfred Wegener, in full Alfred Lothar Wegener, (born November 1, 1880, Berlin, Germany—died November 1930, Greenland), German meteorologist and geophysicist who formulated the first complete statement of the continental drift hypothesis.

8 0
2 years ago
Organisms that have two identical alleles for a particular trait are said to be
densk [106]
Homozygous<span>. An organism that has two identical alleles for a trait.</span>
5 0
2 years ago
Other questions:
  • What does the muscular system do for your body
    5·1 answer
  • How is variation introduced into populations of asexual organisms such as bacteria and amoebas?
    7·1 answer
  • Work occurs when (2 points) Group of answer choices the movement of the object was caused by a force and is in the opposite dire
    14·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Question 4:
    12·1 answer
  • Does medical assistance safeguard or impede the birth process?
    12·2 answers
  • Submit your air quality report for your area, showing seven days, the air quality color for each day, and each day's major
    6·1 answer
  • HELP PLZ ASAP GIVING BRAINLIEST!!
    14·1 answer
  • Ozone in the stratosphere is a form of air pollution,<br> True or False?
    15·2 answers
  • A cactus is adapted for life with limited water. The green
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!