1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna71 [15]
3 years ago
12

A karyotype of a person with Down syndrome is shown here. Which term is used to describe this type of genetic disorder?

Biology
1 answer:
Brums [2.3K]3 years ago
7 0
Trisomy is the correct answer
You might be interested in
Based on physical evidence, scientists have concluded that the planet earth probably formed _____ years ago, and the first life
Sonbull [250]
Planet earth was probaly formed 30,thousand years ago the first life probably evolved 29 thousand years ago
5 0
3 years ago
In the picture above, A.running water is acting as a constructive force as it builds up the mountains
LiRa [457]

Answer:

C

Explanation:

Since the rock is breaking its becoming or acting as a destructive force

7 0
2 years ago
Read 2 more answers
What did Darwin discover about plants from his phototropism experiments?
mel-nik [20]

Answer:

https://www.biology-pages.info/T/Tropisms.html

Explanation:

This link holds all the information you need :D

7 0
2 years ago
Which of the following describes a similarity and a difference between isotopes of an element?
jarptica [38.1K]
Isotopes of an element are defined has that has same atomic number but different mass number mean they have different number of neutrons
so the statement that best describe a similarity is 
<span> same atomic number; different mass number
</span>so correct option is C 
hope it helps

5 0
3 years ago
Need help etm class hard
Irina-Kira [14]

Answer:

Liver

Thoracic

Xiphoid

5 0
3 years ago
Other questions:
  • The nurse is assessing a 10-month-old infant during a checkup. which developmental milestones would the nurse expect the infant
    8·1 answer
  • Kaylee wants to test her hypothesis that she performs better on tests after getting more sleep. In which way will she best be ab
    13·1 answer
  • Peanuts, flax, sunflowers, safflower and cotton are all grown for their_______. (Sugar, vitamins, amino acid, carbohydrate, oil)
    12·1 answer
  • Chemotaxis is the process of what
    11·2 answers
  • A father has two copies of a lactose persistence allele , he is homozygous dominant. The mother has one copy of that allele , sh
    10·2 answers
  • The initial site where bile mixes with chyme
    8·1 answer
  • Two scientists did the same experiment but arrived at different results. The scientists most likely
    11·2 answers
  • Read the passage and identify the method being used. Crude oil is a mixture of many liquids that must be separated into pure sub
    7·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Rudy is analyzing a list of statements about structural organization within
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!