1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natta225 [31]
3 years ago
5

You plant a flower garden. Which of the following flowers in your garden would be least likely to be pollinated by bees?

Biology
2 answers:
Nostrana [21]3 years ago
8 0

a flowr that is lavender and is horizontal

bees are attracted to bright colors

velikii [3]3 years ago
7 0

I think it ia A flower that is red and horizontal.

You might be interested in
Biosphere of the tropical rainforests
Viefleur [7K]

Answer:The Rainforest mesocosm, at the north end of Biosphere 2, was created to simulate several tropical Rainforest habitats. The biome can be divided into the following habitats: Bamboo belt of dense bamboo species was intended to screen the biome from airborne salt that might be entrained from the ocean biome.

Explanation: yes

6 0
3 years ago
Label the cell membrane
Daniel [21]

Answer:

a and b

Explanation:

i don't know ok

but is true

6 0
2 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Apakah fungsi sistem pengangkutan dalam organisma ​
kirza4 [7]
Chicken wing chicken wing hot dog and baloney chillin with my homies
3 0
3 years ago
Read 2 more answers
When looking at an active metabolite of a medication, such as 9-hydroxyrisperidone (paliperidone), how does it differ from the p
cluponka [151]

Paliperidone has low affinity for lipid-rich environments compared from the parent compound risperidone. Due to its hydrophilicity characteristic, paliperidone is capable of hydrogen bonding with other molecules containing water and hydroxyl groups. Lipophilicity is a determining factor for the rate and degree of metabolism of the drug in the body and for crossing the blood–brain barrier (BBB).

Moreover, these differences are implicated in synaptic plasticity and neuronal firing effects in the mechanism of mitochondrial movement, protein expression, and phosphorylation of the drug. Paliperidone as a mood stabilizer is an active metabolite of risperidone with antipsychotic effects used for the treatment of schizophrenia and its associated disorders.

<span> </span>

8 0
3 years ago
Other questions:
  • A cylinder with a mass of 12 g has a radius measuring 2 cm and a height of 6 cm. What is its density? 0.05 g/cm3 0.16 g/cm3 1 g/
    12·2 answers
  • Uppose that you are studying an inducible operon that contains two genes required for the metabolism of compound xyz. gene a enc
    8·1 answer
  • The people of Sumer planted wheat and irrigated their fields in order to have a surplus of food. A. True B. False
    11·2 answers
  • what would have happened if we had cut both the jellyfish glo gene and puc18 plasmid with the EcoR1 restriction enzymes
    15·1 answer
  • 13. Natural selection is the most powerful of all the processes that change what in a
    7·1 answer
  • Where on the earth is the greatest amount of long-term oxygen storage? A) decomposer organisms B) photosynthetic plants C) rocks
    15·1 answer
  • What is the genotype of a women who is a carrier heterozygous for color blindness
    15·1 answer
  • Sand, silt, and clay are formed by mixing humus with ________.
    14·1 answer
  • Help me please this read and the question is down blow the read there are 6 question i will post more this like this so please a
    7·1 answer
  • What is the difference between epidemic and endemic.
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!