1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elixir [45]
3 years ago
6

DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​

Chemistry
1 answer:
Katarina [22]3 years ago
7 0

CGGAUUACGGGCUCAUUGUGGCCA

You might be interested in
Click to review the online content. Then answer the question(s) below, using complete sentences. Scroll down to view additional
stiv31 [10]

Answer:

In 1851 gold-seekers from around the world began pouring into the colonies, changing the course of Australian history. The gold rushes greatly expanded Australia's population, boosted its economy, and led to the emergence of a new national identity.

Explanation:

3 0
3 years ago
Read 2 more answers
Which statements are correct about silicon?
ki77a [65]

Answer:

A. Metalloid

E. Has similar properties as Ge

F. Belongs to Period 3​

Explanation:

Silicon is the 14th element on the periodic table. Its unit is SI. Its properties straddles between those of metals and non-metals and it is described as a non-metal.

It's atomic weight or mass number is 28u. It has an atomic number of 14 i.e in its neutral state, the number of protons and electrons are equal to 14.

Silicon belongs to the 4th group and the 3rd period on the periodic table. Elements in the same group share similar chemical properties. The elements in Si group are: C, Ge, Sn and Pb. The properties of Si is similar to these elements because they all have a valency of 4. Across the period, the properties varies this is why Si would have a very different property from Al and P.

4 0
3 years ago
Diamond has a density of 3.26 g/cm^3. What is the mass of a diamond that has a volume of 25 cm^3?
givi [52]

Answer:

<h2>81.5 g</h2>

Explanation:

The mass of a substance when given the density and volume can be found by using the formula

mass = Density × volume

From the question we have

mass = 25 × 3.26

We have the final answer as

<h3>81.5 g</h3>

Hope this helps you

4 0
3 years ago
How many grams of antifreeze C2H4(OH)2 would be required per 500 g of water to prevent the water from freezing at a temperature
Wewaii [24]

Answer:

333.7 g.

Explanation:

  • The depression in freezing point of water (ΔTf) due to adding a solute to it is given by: <em>ΔTf = Kf.m.</em>

Where, ΔTf is the depression in water freezing point (ΔTf = 20.0°C).

Kf is the molal freezing point depression constant of the solvent (Kf = 1.86 °C/m).

m is the molality of the solution.

<em>∴ m = ΔTf/Kf</em> = (20.0°C)/(1.86 °C/m) = <em>10.75 m.</em>

molaity (m) is the no. of moles of solute per kg of the solvent.

∵ m = (no. of moles of antifreeze C₂H₄(OH)₂)/(mass of water (kg))

∴ no. of moles of antifreeze C₂H₄(OH)₂ = (m)(mass of water (kg)) = (10.75 m)(0.5 kg) = 5.376 mol.

∵ no. of moles = mass/molar mass.

<em>∴ mass of antifreeze C₂H₄(OH)₂ = no. of moles x molar mass </em>= (5.376 mol)(62.07 g/mol) =<em> 333.7 g.</em>

5 0
3 years ago
A public service announcement is created to encourage people to briefly stop using their wireless devices. Which justify the rea
geniusboy [140]

Answer:

A C D on edj

Explanation:

3 0
3 years ago
Other questions:
  • If molar mass of M(OH)3 = 78 8. mass of M​
    9·1 answer
  • Which air pollutant contributes to asthma?
    14·1 answer
  • How much of a 1.00 mg sample of americium remains after 3 half-lives?
    13·2 answers
  • Why is a solution not a pure substance
    9·1 answer
  • 2. Which of the following is not a physical property of water? It is a colorless liquid. It is composed of hydrogen and oxygen.
    7·1 answer
  • How can a person reduce consumption of natural resources when drinking water? Assume that you are not going to change the amount
    7·1 answer
  • you find this receipt and remember it can help you with a lock. You have 9 members in your unit. This will take care of 1 member
    6·1 answer
  • Please help me I need these answers
    13·1 answer
  • 1<br> 2. How does a detergent remove a stain?<br> ?
    8·1 answer
  • Which observation most likely indicates that only a chemical change has taken place
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!