1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elixir [45]
3 years ago
6

DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​

Chemistry
1 answer:
Katarina [22]3 years ago
7 0

CGGAUUACGGGCUCAUUGUGGCCA

You might be interested in
What best discribes the relationship between wavelength and frequency in a electromagnetic wave
Ksivusya [100]

Answer:

The higher the frequency, the shorter the wavelength

Explanation:

All light waves move through a vacuum at the same speed, the number of wave crests passing by a given point in one second depends on the wavelength.

3 0
3 years ago
How many grams of NaCl are in 3.5 mol of NaCl? Also, how many moles of NaCl are in 150 g of NaCl?​
alexandr402 [8]

Answer:

204.5505 grams

2.5666 moles

Explanation:

For the first question, multiply 3.5 (# of moles) by 58.443 (g/mol for NaCl).

58.443 * 3.5

<em>I'll distribute 3.5 into 58.443.</em>

(3.5 * 50) + (3.5 * 8) + (3.5 * 0.4) + (3.5 * 0.04) + (3.5 * 0.003)

175 + 28 + 1.4 + 0.14 + 0.0105

203 + 1.4 + 0.14 + 0.0105

204.4 + 0.14 + 0.0105

204.54 + 0.0105

204.5505 grams

There are 204.5505 grams in 3.5 moles of NaCl.

For the second question, divide 150 (# of grams) by 58.443 (g/mol for NaCl). I'll convert both into fractions.

150/1 * 1000/58443

150000/58443

2.56660336 moles

2.5666 moles (rounded to 4 places to keep consistency with the first answer) are in 150 grams of NaCl.

6 0
3 years ago
This type of bonding can be described as a "cooperation" A. lonic B. metallic C. covalent​
Lostsunrise [7]

Answer:

Explanation:

i think its B. metallic

5 0
2 years ago
Read 2 more answers
What is the boiling point of water when 175.0 g of Na2SO4, a strong electrolyte is dissolved in 1.000 Kg of water?
liubo4ka [24]

Answer: 101.9^0C

Explanation:

Elevation in boiling point is given by:

\Delta T_b=i\times K_b\times m

\Delta T_b=T_b-T_b^0=(T_b-100)^0C = Elevation in boiling point

i= vant hoff factor = 3 (number of ions an electrolyte produce on complete dissociation)

Na_2SO_4\rightarrow 2Na^++SO_4^{2-}

K_f = freezing point constant = 0.512^0C/m

m= molality

\Delta T_b=i\times K_b\times \frac{\text{mass of solute}}{\text{molar mass of solute}\times \text{weight of solvent in kg}}

Weight of solvent (water)= 1.000 kg

Molar mass of solute Na_2SO_4 = 142 g/mol

Mass of solute Na_2SO_4  = 175.0 g

(T_b-100)^0C=3\times 0.512\times \frac{175.0g}{142g/mol\times 1.000kg}

T_b=101.9^0C

Thus the boiling point of water when 175.0 g of Na_2SO_4, a strong electrolyte is dissolved in 1.000 Kg of water is 101.9^0C

8 0
3 years ago
Why must living things rely on thousands of catalysts for chemical reactions necessary for life?
just olya [345]
<span>It affects only one chemical reaction</span>
8 0
3 years ago
Read 2 more answers
Other questions:
  • Noble gases are unreactive because of their electronic structures. The kind of reasoning that states "if other elements could be
    12·1 answer
  • Convert 0.76 kg to grams.<br> plz help, thank you
    7·1 answer
  • What is the effect of adding more water to the following equilibrium reaction?
    11·1 answer
  • Which step is this ?prophase I, Anaphase I, prophase II, Anaphase II
    7·2 answers
  • BALANCE the following equations then write the NET IONIC EQUATION for each one: ____Ni(NO​ 3​ )​ 2​​(aq)​ + ____NaOH ​(aq)​ ​→ ​
    5·1 answer
  • As mentioned in the kinetic molecular theory, what is the main reason that the volume of gas particles can be considered zero?
    7·1 answer
  • Someone please come thru i need help with this quiz
    5·1 answer
  • HELP ASAP!
    6·1 answer
  • When compared to the standard hydrogen electrode, zinc has a reduction potential of -0.762 volts and copper a reduction potentia
    14·1 answer
  • How does acid base extraction work.
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!