1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elixir [45]
3 years ago
6

DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​

Chemistry
1 answer:
Katarina [22]3 years ago
7 0

CGGAUUACGGGCUCAUUGUGGCCA

You might be interested in
What is the mole ratio of N2 to H2 to NH3?
Alexeev081 [22]

Answer:

the answer is 1:3:2

Hope this helps, let me know if you need any other help, Stoichiometry is hard

4 0
3 years ago
Name one way igneous rock is different from metamorphic rock.
nasty-shy [4]

Answer:

Metamorphic rock is classified by texture and composition. The texture of a metamorphic rock can be either foliated and appear layered or banded, or non-foliated and appear uniform in texture without banding. Foliated rocks contain many different kinds of minerals, but non-foliated rocks contain only one main mineral, which contributes to their more uniform appearance.  Igneous rocks are classified according to mode of occurrence, texture, mineralogy, chemical composition, and the geometry of the igneous body.

Explanation:

6 0
3 years ago
A household cleaner has a pH around 10. It would be considered
anyanavicka [17]

Answer:

an acid

Explanation:

A household cleaner has a pH around 10. It would be considered. a base. an acid. neutral. a liquid.

4 0
2 years ago
Read 2 more answers
Analyze Using the photo above, solve the
olga nikolaevna [1]
It changes state

Meaning, it goes from solid to liquid, making it change its state. Hope this helped.
4 0
3 years ago
Read 2 more answers
Why Does A Candle Go Out When You Blow On It ?
Bond [772]
Because of the wind and the cold from ur breath 
5 0
3 years ago
Read 2 more answers
Other questions:
  • A board measures 212 inches. How many feet is this?
    9·2 answers
  • Balance the following skeleton reaction and identify the oxidizing and reducing agents: Include the states of all reactants and
    7·1 answer
  • A galvanic cell with E o cell = 0.30 V can be constructed using an iron electrode in a 1.0 M Fe(NO3)2 solution, and either a tin
    5·1 answer
  • What is"An Elephant's Excellent trunk"mostly about?
    15·2 answers
  • Benzene contains six carbon atoms bonded in a ring. which best describes these bonds?
    9·2 answers
  • Paragraph to your girlfriend
    13·2 answers
  • Explain what happens to the energy in a wave when a sound is louder.
    11·1 answer
  • Calculate the percentage of yield when 20 grams of sodium chloride solution reacts with an excess amount of silver nitrate solut
    9·1 answer
  • Does the temperature of the solvent (water) affect the rate of dissolving?​
    7·1 answer
  • What does it mean when it asks for the planet’s composition?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!