1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elixir [45]
3 years ago
6

DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​

Chemistry
1 answer:
Katarina [22]3 years ago
7 0

CGGAUUACGGGCUCAUUGUGGCCA

You might be interested in
An atom with atomic number of 6 would have how many protons?
aalyn [17]

Answer:

6

Explanation:

Any atom with the atomic number 6 is carbon and has 6 protons

4 0
4 years ago
Read 2 more answers
Deterioration of buildings, bridges, and other structures through the rusting of iron costs millions of dollars a day. The actua
GrogVix [38]

The value of ∆H when 0.250kg of iron rusts is -1.846 × 10³kJ.

The rust forms when 4.85X10³ kJ of heat is released is 888.916 g.

<h3>Chemical reaction:</h3>

4 Fe + 3O2 ------ 2Fe2O3

∆H = -1.65×10³kJ

A) Given,

mass of iron = 0.250kg = 250 g

<h3>Calculation of number of moles</h3>

moles = given mass/ molar mass

= 250/ 55.85 g/mol.

= 4.476 mol

As we know that,

For the rusting of 4 moles of Fe, ∆H = -1.65×10³kJ

For the rusting of 4.476 moles of Fe ∆H required can be calculated as

-1.65×10³kJ × 4.476 mol/ 4mol

∆H required = -1.846 × 10³kJ

Now,

when 2 mol of Fe2O3 formed, ∆H = - 1.65×10³kJ

It can be said that,

-1.65×10³kJ energy released when 2 mol of Fe2O3 formed

So, -4.6 × 10³kJ energy released when 2 mol of Fe2O3 formed

= 2 × -4.6 × 10³kJ / -1.65×10³kJ

= 5.57 mol of Fe2O3 formed

Now,

mass of Fe2O3 formed = 5.57 mol × 159.59 g/mol

= 888.916 g

Thus, we calculated that the rust forms when 4.85X10³ kJ of heat is released is 888.916 g. and the value of ∆H when 0.250kg of iron rusts is -1.846 × 10³kJ.

learn more about ∆H:

brainly.com/question/24170335

#SPJ4

DISCLAIMER:

The given question is incomplete. Below is the complete question

QUESTION:

Deterioration of buildings, bridges, and other structures through the rusting of iron costs millions of dollars a day. The actual process requires water, but a simplified equation is 4Fe(s) + 3O₂(g) → 2Fe₂O₃(s) ΔH = -1.65×10³kJ

a) What is the ∆H when 0.250kg iron rusts.

(b) How much rust forms when 4.85X10³ kJ of heat is released?

7 0
2 years ago
Which group of extremophiles does thermus aquaticus belong to
Elan Coil [88]

Answer:

The correct answer is thermophiles.

Explanation:

Thermus aquaticus are heat resistant bacteria because these bacteria can survive under adverse environmental conditions like high temperature.

These bacteria belong to one of the most heat-loving groups of extremophiles that are thermophiles. Thermophiles are present in volcanic soil, geysers and around deep-sea vents where the temperature is extremely high.

Thermus aquaticus bacteria is used to manufacture an enzyme called Taq DNA polymerase, which is heat resistant and also an important factor in molecular biology.

7 0
4 years ago
Read 2 more answers
How does heat move from one place to another on the troposphere
d1i1m1o1n [39]

I thinlk it's by radiation?......

8 0
4 years ago
What is the chemical equation( formula ) of the reaction of photosynthesis
LekaFEV [45]

Answer:

The process of photosynthesis is commonly written as: 6CO2 + 6H2O → C6H12O6 + 6O2.

Explanation:

This means that the reactants, six carbon dioxide molecules and six water molecules, are converted by light energy captured by chlorophyll (implied by the arrow) into a sugar molecule and six oxygen molecules, the products.

4 0
3 years ago
Other questions:
  • Consider the standard galvanic cell based on the following half-reactions The electrodes in this cell are and . Does the cell po
    15·1 answer
  • What is conditional reflexes?? ​
    5·1 answer
  • According to Dalton's atomic theory, which statement is true about atoms of the same element? They can be destroyed. They have i
    8·2 answers
  • When will Le Chatelier's principle come into effect?
    8·2 answers
  • An ionic compound has a very positive heat of solution in water. Would you expect it to be very soluble or insoluble in water?
    12·1 answer
  • What is one example of a molecule that is not a compound?
    7·2 answers
  • A student increases the temperature of a 417cm³ balloon from 278k to 231k. Assuming constant pressure, what should the new volum
    12·1 answer
  • PLZ HELP WILL BRAINLIEST
    12·1 answer
  • Calculate the number of molecules in 7 moles of oxygen
    13·1 answer
  • The beakers on the left and right both contain the same amount of HCL (liquid) and the same mass of calcium carbonate (solid). I
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!