1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elixir [45]
3 years ago
6

DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​

Chemistry
1 answer:
Katarina [22]3 years ago
7 0

CGGAUUACGGGCUCAUUGUGGCCA

You might be interested in
2 reasons for chemical reactivity of nitrogen
erma4kov [3.2K]

Answer:

Due to presence of a triple bond between the two N−atoms, the bond dissociation enthalpy (941.4 kJ mol  

−1

) is very high. Hence, N  

2

​

 is the least reactive.

6 0
3 years ago
How many grams of oxygen would be needed to completely react with 18 grams of methane (CH4)?
S_A_V [24]

Answer:

35.91 grams of oxygen

Explanation:

6 0
3 years ago
determine the freezing point depression of a solution that contains 30.7 g glycerin (c3h8o3, molar mass
Blababa [14]

The freezing point depression of a solution containing 30.7 g of glycerin  is  calculated as -1.65°C

Equating :

It is given that,

Given mass of glycerin is = 30.7 grams (Solute)

Volume of water = 376 mL

K_{f}or molar -freezing-depression point is = 1.86°C/m

Molar mass of glycerin = 92.09 g/mole

Now, to work out the value, the mass of water should be known. Thus, to calculate, the formula used will be:

Mass = Density X Volume

Mass = 1.0 g/mL X 376 mL

Mass = 376 g or 0.376 Kg

Using the formula of melting point depression, the equation becomes:

             ΔT_{f} = i ×K_{f} ×m

T⁰-T_{s}  = i *K_{f} *\frac{mass of glycerin}{molar mass of glycerin * mass of water     in     kg}

in which,

ΔT_{f} = change in freezing point

ΔT_{s} = freezing point of solution that has to be find

ΔT° = freezing point of water ()

Since, glycerin is a non-electrolyte, the Van't Hoff factor will be 1.

Substituting the values in the above equation:

0⁰C₋T_{s} = 1 ×1.86°C/m ×\frac{30.7}{92.09g/mol * 0.376kg}

T_{s} = -1.65°C

Thus, the freezing point depression of a solution is  -1.65°C

<h2 />

Freezing point depression

Freezing point depression is a colligative property observed in solutions that results from the introduction of solute molecules to a solvent. The freezing points of solutions are all less than that of the pure solvent and is directly proportional to the molality of the solute

Is melting point elevation or depression?

Boiling point elevation is that the raising of a solvent's boiling point due to the addition of a solute. Similarly, melting point depression is the lowering of a solvent's freezing point due to the addition of a solute. In fact, because the boiling point of a solvent increases, its melting point decreases

Learn more about freezing point depression :

brainly.com/question/26525184

#SPJ4

8 0
11 months ago
What are the two different ions present in the compound al(no3)3?
Aleks [24]

Al^{3+} and NO_3^{-}

Aluminum nitrate is an ionic compound, meaning that it is made up cations and anions. By convention when writing the formula for an ionic compounds the cation part shall be placed in front the anions. Thus the cation would contain aluminum and the anion shall be a polyatomic nitrate ion consisting of nitrogen and oxygen. The bracket with subscript 3 attached resembles the ratio between the two species, aluminum ions and nitrate ions. For each aluminum ion in the compound there shall be three corresponding nitrate ions.

Aluminum form ions of charge +3 whereas nitrate ions are of charge -1. Write the charge of the ion as the superscript in reverse (i.e., write 3+ as in Al^{3+} and - in NO_3^{-}, omitting any 1.)

5 0
3 years ago
How do plant and animal cells compare
masya89 [10]
A difference between plant cells and animal cells is that most animal cells are found whereas most plant cells are rectangular. Plant cells have rigid cell wall that surrounds the cell membrane.animals do not have a cell wall
6 0
3 years ago
Other questions:
  • Write the balanced half-equation describing the oxidation of mercury to hgo in a basic aqueous solution. Please include the stat
    12·1 answer
  • Which shows the formula for an Organic acid
    14·1 answer
  • In an ionic compound, every ion _____.
    11·2 answers
  • The reaction described by H2(g)+I2(g)⟶2HI(g) has an experimentally determined rate law of rate=k[H2][I2] Some proposed mechanism
    12·1 answer
  • If a 2.0 mL of 3.0 M HCl is used to make a 250 mL aqueous solution, what is the molarity of the dilute solution?
    6·2 answers
  • 8. How would you describe kelp? (2 points)
    11·1 answer
  • What is the average mass of a single argon atom in grams?
    5·1 answer
  • Earthvhas several ideal features which enable it to support life. MOST important is the
    8·1 answer
  • Cual Fue la teoria de la<br>Cuatro elementos​
    5·1 answer
  • Three difference between radicle and plumule​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!