1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elixir [45]
3 years ago
6

DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​

Chemistry
1 answer:
Katarina [22]3 years ago
7 0

CGGAUUACGGGCUCAUUGUGGCCA

You might be interested in
Copper is malleable, ductile, and conducts heat and electricity. Would you classify copper as a metal, nonmetal, or metalloid? W
Morgarella [4.7K]

Answer:

The elements can be classified as metals, nonmetals, or metalloids. Metals are good conductors of heat and electricity, and are malleable (they can be ... and electricity, and are not malleable or ductile; many of the elemental nonmetals are ... under certain circumstances, several of them can be made to conduct electricity.

Hope this helps!

Explanation:

5 0
2 years ago
Read 2 more answers
A block of metal has a mass of 0.0694 kg. It displaces 3.6 mL of water. What is it’s density in g/cm^3
Ivan

Answer:

19.28 g/cm^3 to the nearest hundredth.

Explanation:

The volume of water displaced = the volume of the metal.

density = mass / volume

0.0694 kg = 0.0694 * 1000

=  69.4 g.

Density = 69.4 / 3.6

= 19.28 g/cm^3.

4 0
3 years ago
What process is used to release energy in nuclear power plants?
lukranit [14]
Nuclear fission is used enable to release energy in power plants. The constant collision of particles within the reactor, create most of the plants energy.
6 0
3 years ago
Read 2 more answers
Water acts as a solvent.<br> a. True<br> b. False
Talja [164]
True. Water acts as a solvent as the solute dissolves into water. 
7 0
3 years ago
If a man has brown eye with the recessive gene for blue eyes (Bb), each of his sex cells will have
iren [92.7K]
B - brown eyes
b - blue eyes

If we were to fill out a punette square each of his sex cells would contain at least one brown eyed gene. 
8 0
3 years ago
Read 2 more answers
Other questions:
  • This picture depicts secondary succession in a Forest ecosystem.
    7·1 answer
  • Gasoline in a storage tank potential or kinetic?
    15·2 answers
  • How can so many different substances in the world be made of so few elements?
    10·1 answer
  • What statement describes a good scientific question? Check all that apply.<br>Please help mee!​
    8·1 answer
  • Use the drop-down menus to complete the statements about inertia, earth, and the moon.
    14·2 answers
  • Infectious agents vary in their size and shape. Which infectious agent tends to be the smallest?
    5·1 answer
  • A balloon with a volume of 2.0 L is filled with gas at 3 atm. If the pressure is reduced to 1.5 atm without a change in temperat
    9·1 answer
  • If a 520 mg sample of technetium-99 is used for diagnostic procedure, how much of Tc-99 remains after 30.0h? Half life of Tc-99
    15·1 answer
  • Sarah is investigating the transfer of energy in the
    14·2 answers
  • How is the rock cycle related to chemistry??
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!