1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elixir [45]
3 years ago
6

DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​

Chemistry
1 answer:
Katarina [22]3 years ago
7 0

CGGAUUACGGGCUCAUUGUGGCCA

You might be interested in
Which element in period 3 has three times the electronegativity value compared to that of li in period 2
victus00 [196]

Answer:

Nitrogen

Explanation:

Elements in period two includes lithium, beryllium, boron, carbon, nitrogen, oxygen, fluorine and neon.

According to periodic trends, the electro negativity values are expected to increase across the period up to fluorine. Hence, as we go right wards, we encounter elements with higher electronegative values.

While lithium has an electronegative value of 1 , the electronegative value of element nitrogen is thrrr times this which is equal to three

7 0
3 years ago
Read 2 more answers
a thermometer containing 8.3g of mercury has broken. if mercury ha a density of 13.6g/mL. what volume is spilled?
scoray [572]
D = m / V

13.6 = 8.3 / V

V = 8.3 / 13.6

V = 0.610 mL

hope this helps!
4 0
4 years ago
Read 2 more answers
HELP PLS !!!! :))Formula unit of Sr and CI<br><br> Formula unit of AI and S
xenn [34]

Answer : The formula unit of Sr & Cl is SrCl_2 and the formula unit of Al & S is Al_2S_3

Explanation :

Formula unit : it is defined as the lowest number ratio of ions of an elements in an ionic compound or covalent compound.

For the formula unit of Sr & Cl, two chloride ions(Cl^-) are needed to neutralize the one strontium ion(Sr^{2+}).

For the formula unit of Al & S, three sulfide ions(S^{2-}) are needed to neutralize the two aluminium ion(Al^{3+}).

The formula unit of SrCl_2 and Al_2S_3 are shown below.

4 0
3 years ago
Is potassium a compound?​
Drupady [299]
Potassium itself is not a compound, it’s an element. Represented by “K” and has an atomic number of 19. However, it can be used to make a compound
8 0
3 years ago
Which of the following describes the role of water in supporting the chemical reactions that occur within various life forms? It
wel

Answer:

The correct option is;

It is used during photosynthesis to capture sunlight

Explanation:

During photosynthesis, light energy from the Sun is converted and stored in sugars as chemical energy. The Sun light energy is used in the formation of complex sugars such as glucose from the combination of water from the ground and carbon dioxide from the atmosphere while oxygen is released as the byproduct. Organisms are then able to obtain energy from the glucose as well as carbon fiber

The chemical equation for the reaction is as follows;

6CO₂     + 12H₂O + light energy → C₂H₁₂O₆  +  6O₂ + 6H₂O

Carbon,     Water,                            GLucose,  Oxygen,   Water

dioxide

4 0
3 years ago
Read 2 more answers
Other questions:
  • how many electrons are transferred between the cation and anion to form the ionic bond in one formula unit of each compound? (1
    13·2 answers
  • Use the words protons neutrons and I suppose in the same sentence ​
    5·1 answer
  • Determine two complex numbers, (a+bi) and (c+di), where a and d are irrational numbers and b and c are rational number
    5·2 answers
  • The pH of a solution is 8.83±0.048.83±0.04 . What is the concentration of H+H+ in the solution and its absolute uncertainty?
    6·1 answer
  • A 3.140 molal solution of NaCl is prepared. How many grams of NaCl are present in a sample containing 2.314 kg of water?
    6·1 answer
  • Assuming that the bath contains 250.0 g of water and that the calorimeter itself absorbs a negligible amount of heat, calculate
    6·1 answer
  • . Which law of motion relates the action of a stretched rubber band
    8·1 answer
  • Question 2 of 10 A scientist is interested in designing an alternative cancer treatment involving a less harmful type of radiati
    14·1 answer
  • why do you think you can find silver and gold on their own in rocks but calcium and magnesium are combined with other elements t
    13·2 answers
  • Is acid rain a global or a regional concern ?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!