1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elixir [45]
3 years ago
6

DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​

Chemistry
1 answer:
Katarina [22]3 years ago
7 0

CGGAUUACGGGCUCAUUGUGGCCA

You might be interested in
What is the solubility of nitrogen and calcium nitrate in cyclohexane?
Sav [38]
I don't know man hahahaha
8 0
3 years ago
Which one of these examples shows a homogeneous mixture? oil and vinegar or salt water
kumpel [21]
<span>chemical combination of two or more elements in definite proportions.  For example, two hydrogen molecules + one oxygen molecule= one water molecule.  A solution is a physical combination of two or more chemicals mixed evenly (salt that is dissolved in water).  Solutions are also known as homogenous mixtures.  A mechanical mixture is a physical combination of two or more chemicals that are not evenly mixed (hot fudge on ice cream). </span>
4 0
3 years ago
Read 2 more answers
A fungus like the one that causes athletes foot causes disease by? A producing allergies B spreading spores c absorbing nutrient
goblinko [34]
I think the answer is B spreading spores.
6 0
3 years ago
Read 2 more answers
How many atoms make up a diatomic molecule?
zalisa [80]
The prefix 'di' means two. Hence two atoms make up a diatomic molecule.
Hope this helps!
6 0
3 years ago
What is produced in photosynthesis
dolphi86 [110]
Energy for the plant. It’s a glucose
6 0
4 years ago
Read 2 more answers
Other questions:
  • An element has two naturally occurring isotopes, X-85 with a mass of 84.9118 amu and a natural abundance of 72.17%, and X-87 wit
    8·1 answer
  • How long does it take for a ketchup to dry on clothes
    15·1 answer
  • How does I meter in France compare to I meter in America?
    12·1 answer
  • What era is know as the age of mammals?
    13·1 answer
  • What is the electron configuration for<br> 08<br> 16
    11·1 answer
  • Help pleaseee.... :(
    12·2 answers
  • Describe the formation of covalent bond in methane (5 marks) ​
    15·2 answers
  • Describe the relationship between kinetic energy and speed, and give an example of how changing an object’s speed would affect i
    5·1 answer
  • Name the organ system that allows us to take in glucose
    6·1 answer
  • Please help asap!!!!!!!
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!