1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elixir [45]
3 years ago
6

DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​

Chemistry
1 answer:
Katarina [22]3 years ago
7 0

CGGAUUACGGGCUCAUUGUGGCCA

You might be interested in
Is the indicator generally added to the titrant or the analyte in a titration?
Nina [5.8K]
In a titration process, the unknown or the analyte with a known volume is placed in a flask and the titrant whose concentration is known is placed in the burette. The indicator in the titration process is generally added to the flask with the analyte. 
5 0
3 years ago
Read 2 more answers
What is the molar concentration of a 2 liter solution containing 200 grams of glucose?
NARA [144]

The molar concentration is 1.11M.

<h3>What is molar concentration?</h3>

The phrase "molar concentration" (also known as "molarity," "amount concentration," or "substance concentration") refers to the amount of a substance per unit volume of solution and is used to describe the concentration of a chemical species, specifically a solute, in a solution. The most frequent measure of molarity in chemistry is the number of moles per liter, denoted by the unit symbol mol/L or mol/dm3 in SI units. A solution with a concentration of 1 mol/L is referred to as 1 molar, or 1 M.

<h3>Given : </h3>

Volume of the solution = 2L

Mass of glucose given = 200g

Concentration of glucose= ?

<h3>Formula use: </h3>

Molarity = no. of moles of solute / volume of the solution (L)

Moles of solute = given mass of solute / molar mass of the solute

<h3>Solution: </h3>

No. of moles of solute( glucose ) = 200 / 180 = 1.11 moles'

Molarity = 1.11 / 2 = 0.5555 mol L ^(-1)

Therefore, the molar concentration of glucose in the solution = 0.555 mol L ^(-1)

To learn more about molar concentration :

brainly.com/question/15532279

#SPJ4

8 0
2 years ago
What best explains why the sun maintains its size and shape?
Marina86 [1]
Pressure caused by high temperatures are balanced by gravity
3 0
3 years ago
Read 2 more answers
Which of the following describes a synthesis reaction?
Grace [21]

Answer:

D. Two reactants combine to form one product

Explanation:

The definition of synthesis in chemistry is "the production of chemical compounds by reaction from simpler materials."

A is decomposition, B is DOUBLE replacement, and C is SINGLE replacement.

7 0
3 years ago
To whoever helps me thank you so much have a wonderful day!
Schach [20]

Answer:

N and P

Explanation:

Anion:

When an atom gain the electrons anion is formed. The negative sign shows that atom gain electron because number of electron are greater than protons or we can say that negative charge becomes greater than positive charge.

Cation:

When atom lose electron cation is formed. The atom thus have positive charge because number of positive charge i.e protons are increased are greater than negative charge or electron.

In given problem N and phosphorus both can gain three electrons which means negative charge becomes greater that's why the extra electron gained by atoms are written as -3 and both form anion with charge -3.

while Al form cation with charge +3 Mg form cation with charge +2 and iodine and bromine both form anion with charge of -1.

8 0
3 years ago
Other questions:
  • Rutherford created a planetary model for atoms after his experiments. Imagine if Rutherford's idea that electrons radiate energy
    15·2 answers
  • Discuss the significance of assigning an atomic mass of exactly 12 amu to the carbon-12 isotope.
    5·1 answer
  • How does geothermal energy differ from solar energy? (3 points)
    8·2 answers
  • How many weeks does it take for one full moon to go to the next full moon
    6·2 answers
  • Acetic acid is a weak acid in water because it is:
    6·1 answer
  • Which ion will oxidize Fe? 1) Zn+2 2)Ca+2 3) Mg+2 4) Cu+2
    8·1 answer
  • A particle has 5 protons, 6 neutrons, and 5 electrons. What is its net charge.
    15·1 answer
  • A cooling curve has two flat lines, or plateaus. What does the plateau at the higher temperature represent?
    14·2 answers
  • A photon of visible light can be emitted when
    11·1 answer
  • The following are electronegativity. What value should be where the M is?0.981.57M2.553.043.443.98No data
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!