1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elixir [45]
3 years ago
6

DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​

Chemistry
1 answer:
Katarina [22]3 years ago
7 0

CGGAUUACGGGCUCAUUGUGGCCA

You might be interested in
Two groups of students were tested to compare their speed working math problems. Each group was given the same problems. One gro
jeka57 [31]
The independent variable is the variable being changed. In this case, the independent variable is the calculators. The dependent variable is essentially what you are looking for that <u>depends</u> on the independent variable. In this case it would be time. The constant variable or controlled variable are something that doesn't change and would skew the results. One may be the exact same problem for both groups. Try to come up with two more.
7 0
3 years ago
Read 2 more answers
which of the following is not part of the big bang theory?A. In the beginning the universe was too hot for atoms to exist. B. As
erastovalidia [21]
A.) In the beginning the universe was too hot for atoms to exist. 

Because choice b,c,and d are all part of the big  bang theory.
8 0
3 years ago
Read 2 more answers
PLease help!!! Im in the process of taking my final!!!!! HELPPPPP
Katarina [22]

Answer:

The answer to your question is Aluminum

Explanation:

Number of clues

1.- If this element has 3 rings in its Bohr model, we are looking for and element located in the third period of the periodic table.

For example Sodium, Magnesium, Aluminum, Silicate, Phosphorus, Sulfur, Chlorine and, Argon.

2.- It makes three bonds to become stable, then we are looking for and element located in the third group like

 Boron, Aluminum,  Gallium, Indium, etc

Conclusion

The element that has both characteristics is Aluminum

8 0
3 years ago
A chemistry student needs 50.0 g of methyl acetate for an experiment. By consulting the CRC Handbook of Chemistry and Physics, t
slamgirl [31]

Explanation:

As density is defined as the mass of a substance divided by its volume.

Mathematically,         Density = \frac{mass}{volume}

It is given that mass is 50 g and density is 0.934 g/cm^{3}.

Hence, calculate the volume of methyl acetate as follows.

                     Density = \frac{mass}{volume}

             0.934 g/cm^{3} = \frac{50 g}{volume}

                       Volume = 53.53 cm^{3}

or,                                  = 53.53 ml                (as 1 cm^{3} = 1 mL)

Thus, we can conclude that the volume of methyl acetate the student should pour out is 53.53 ml.

3 0
3 years ago
What element is likely to form an ionic compound with chlorine?
kirill [66]
Sodium (NA)
the sodium atom is donating its 1 valence electron to the chlorine atom. This creates a sodium cation and a chlorine anion. Notice that the net charge of the resulting compound is 0.

5 0
3 years ago
Other questions:
  • Calculate the mass percent of a solution prepared by dissolving 17.2 g of NaCl in
    5·2 answers
  • How can you know if evolution has occured within species?​
    10·1 answer
  • A slice of cheese has a mass of 21 g and a volume of 15 cm3. What is the density of the cheese in units of g/cm3 and g/mL?
    11·1 answer
  • Technician A says that water floats to the top of fuel in the tank. Technician B says that water is more likely to be drawn into
    14·1 answer
  • Ethylene glycol, C2H6O2, is infinitely miscible (soluble) in water. It is a nonelectrolyte that is used as antifreeze. What is t
    11·1 answer
  • A scientific theory is _____.What have chemists done to help people conserve energy?
    7·1 answer
  • True or false: The force exerted onto an object must be perpendicular to the displacement if work is to be considered done.
    10·1 answer
  • g Which of the following solutes in aqueous solution would be expected to exhibit the smallest freezing-point lowering (assuming
    12·1 answer
  • Send help thank u asap
    9·2 answers
  • What is the approximate pH of a solution labeled 0.050 M HCLO ?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!