1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
adoni [48]
3 years ago
8

______________ came to mean the study or practice of improving the human race through selective breeding and, sometimes, restric

tive immigration policies.
Biology
1 answer:
Nataliya [291]3 years ago
7 0
<h2>Human Biology </h2>

Explanation:

  • <u>Negative eugenics </u>came to mean the study or practice of improving the human race through selective breeding and, sometimes, restrictive immigration policies
  • Our bodies comprise of various <em>natural biological systems</em> that complete explicit capacities vital for ordinary living
  • The activity of the <em>circulatory system</em> is to move blood, supplements, <em>oxygen, carbon dioxide, and hormones, around the body</em>
  • <em>It comprises of the heart, blood, blood vessels,arteries and veins.  </em>
  • People are an essential piece of biological systems
  • Biological systems give an assortment of advantages to individuals, including including <em>provisioning, regulating, cultural, and supporting services. </em>

You might be interested in
Use the graph below to answer the following question: What is happening to the object's velocity
JulsSmile [24]

we need a graph to do this can u provide a picture?

3 0
3 years ago
How similar are daughter cells to each other and to the original parent cell?
Gala2k [10]
Idk thats a good question to ask your science teacher
7 0
3 years ago
Based on the diagram above, which best describes the structure and function of C?
Tresset [83]

Answer:

Answer is A.

Explanation:

C is pointing out the uterus, which is described in option A.

A is pointing out the ovary, which is described in option D.

B is pointing out the fallopian tube, which is described in option B.

Option C describes the cervix, which is not labeled in the diagram.

8 0
3 years ago
Read 2 more answers
Please help meeeeeeeee???!!!
Eddi Din [679]

Answer:

A.

Explanation:

3 0
3 years ago
Read 2 more answers
What do stomata do for a plant
enot [183]
Stomata acts as a nose for the plant,through which it can respire.Through stomata carbondioxide enters into the plant and oxygen will be released.
4 0
3 years ago
Read 2 more answers
Other questions:
  • On which feature is science based?
    13·2 answers
  • Vascular plants transport nutrients through specialized structures called xylem and phloem. What is the purpose of the xylern?
    9·1 answer
  • What are the basic building blocks of DNA and RNA
    8·1 answer
  • What is the power house of the cell
    6·2 answers
  • Wild diploid wheat has seven chromosomes in its pollen. Discuss the major events that had to occur for tetraploid pasta wheat to
    7·1 answer
  • GMO's ( Genetically Modified Organism)
    9·1 answer
  • Which labeled part in the photo shows an induced magnet?
    13·1 answer
  • Pls help!! ill give brainlest !!
    10·2 answers
  • Help me please!!!!<br> I am not good at science
    13·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!