1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex17521 [72]
3 years ago
6

A mug is filled with coffee. Which property is an intensive property of the coffee in the mugg

Chemistry
1 answer:
azamat3 years ago
3 0
I think it would be option A but it’s either A 0r B
You might be interested in
Help meee??
Luden [163]
Answer: Monoprotic Acid
6 0
2 years ago
What is the molarity of a sodium hydroxide solution containing 2 moles of NaOH with a volume of .5L?
Maksim231197 [3]

Answer:

0.4M NaOH

Explanation:

Molarity, M, is an unit of concentration widely used defined as the ratio between moles of solute (In this case, NaOH) and volume of solution in liters.

As the solution contains 2 moles of NaOH-Moles of solute- in 5L of solution, the molarity is:

2 moles NaOH /  5L =

<h3>0.4M NaOH</h3>
5 0
2 years ago
Ab cd and Ef intersect at p. If r=90, s=50, t=60, u= 45 and w=50, what is the value of x?
ziro4ka [17]

Answer:

8

Explanation:

3 0
3 years ago
6. Explain the impact on fresh water of:
Paraphin [41]

Fresh water pollutants  are substances which pollute fresh water and  industrial waste, is most harmful fresh water pollutant to man and aquatic organisms.

<h3>What are pollutants?</h3>

Pollutants are substances which cause harm when they are present in the environment.

Pollutants include chemicals such as petroleum and material such as sewage.

The presence of pollutants in freshwater results in water pollution and make the water unfit for drinking purposes and also harms aquatic life in freshwaters.

Some freshwater pollutants include:

  • Farming wastes
  • Household pollutants
  • Industrial wastes
  • Erosion
  • Oil and Gasoline
  • heat

Of these pollutants, the most dangerous fresh water pollutant is industrial wastes as they kill aquatic organisms most due to the presence of harmful chemicals in them.

Therefore, fresh water pollutants such as industrial waste is most harmful to man and aquatic organisms.

Learn more about pollutants at: brainly.com/question/1235358

#SPJ1

5 0
1 year ago
Energy is just like any other chemical or physical process, where it cannot be created or destroyed. Which Law states this fact?
Ganezh [65]

Answer:

Law of Conservation of Energy

Explanation:

5 0
3 years ago
Other questions:
  • Prove that an element has an order in an abelian group
    13·1 answer
  • A student performed an investigation at sea level. First she placed 400 mL of water in four different containers. Then she place
    9·1 answer
  • What type of glassware is useful for transferring liquids from a big container to a small container?
    8·2 answers
  • 13. Which of the following has the highest amount of kinetic energy?
    13·1 answer
  • True or false water and salt are examples of elements
    10·2 answers
  • The volume of a certain bacterial cell is 1.60 μm3. Give your answers in scientific notation. (a) What is its volume in cubic mi
    14·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Select the correct answer.
    12·1 answer
  • Ammonium carbonate decomposes upon heating according to
    10·1 answer
  • What is the percent composition of N H S O in (NH4)2SO4
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!