1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stealth61 [152]
3 years ago
5

Describe one energy conversion that takes place in a hydroelectric power plant

Biology
1 answer:
Vesnalui [34]3 years ago
3 0
Potential energy (water in Dam) to Kinetic energy (Water flowing down to generator) to mechanical energy (Water turning generator) to magnetic energy (in airgap of the generator) to Electrical energy (in the coils of the generator) is your answer .-.
You might be interested in
.Origin of species was given by
Oduvanchick [21]

Answer:

Charles Darwin

Explanation:

4 0
3 years ago
Read 2 more answers
When the shell of a pteropod (sea butterfly) was placed into seawater with the pH expected at the end of the century, the shell
geniusboy [140]

Answer:

the answer is c.

oceanic acidification is occurring, which results in shelled creatures, clams, lobster, to have weaker shells as a defense. the shells break easily and are too weak to protect the organisms inside, unable to properly calcify their shells leaves them vulnerable to preditors...

3 0
2 years ago
Which objects allow humans to access groundwater? Check all that apply.
Masja [62]
<h2>Answer:</h2>

<u>The objects that allow humans to access ground water are:</u>

  • <u>A spring</u>
  • <u>a well drilled into an aquifer </u>
  • <u>a well drilled below the water table</u>
<h2>Explanation:</h2>

Access to ground water can be gained if we dig a well or use any source that can provide us an access below the water table. A water table is the level below which the ground is saturated with water. So above the saturation level we cannot gain access to water therefore we must go below it. A spring springs from ground below water table and the same thing occurs for well or an aquifer if it is below the water table..

8 0
3 years ago
Read 2 more answers
Which organism receives the most energy in the food chain
slamgirl [31]

Answer:

humans

Explanation:

7 0
2 years ago
What benefits do plants with a smooth stem have? Does the stem type protect a plant?
gogolik [260]
<h3><u>Benefits of smooth stem  over rough stem:</u></h3>

Smooth stem plants like guava, eucalyptus etc do have a smooth layer of bark over its stem that comes out as a skin when they shed their barks. Whereas most of the other plants like mango, banyan etc do have a rough corrugated layer of bark over their stem.

The smooth stem doesn’t let water to accumulate in the bark which can led to infections to the tree. It also doesn’t allow any seed to settle on bark that can led to growth of parasites. Thereby this smooth bark saves the trees from some of the probable harm to the tree.  

7 0
2 years ago
Other questions:
  • Figure 15-1 is an example of heat transfer by ____________________.
    11·2 answers
  • Imagine a situation in which the number of urea leak channels increased dramatically in the ascending limb of the loop of Henle.
    15·1 answer
  • All chordates have _____ (at some point in their life cycle). feathers diaphragm fins pharyngeal pouches
    14·1 answer
  • Bena thinks that dissolving more salt in water causes the mixture’s freezing temperature to change.
    14·2 answers
  • What is the environment in Madagascar <br><br> PLZ ANSWER 20 PTS
    11·2 answers
  • Responding to the environment by maintaining a stable internal environment despite changing external conditions is
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • In most energy sources such as fossil fuels where is the energy originally derived from?
    12·1 answer
  • How do bogs keep themselves cool
    5·1 answer
  • Why was soil in wheat farms so much more vulnerable to erosion?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!