1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dedylja [7]
3 years ago
8

PLS HELP ME!!! In your opinion, what are the limiting factors that might affect the growth or diversity of our ecosystem? Please

respond to this question in Claim, Evidence, Reasoning format. 1. Make your claim (I claim______ are the limiting factors that might affect the growth or diversity of our ecosystem.). 2. Follow the claim with 3 pieces of evidence. Evidence may be taken from the reading, the videos, previous lessons, or Googled answers. Please site sources, too. 3. Use reasoning to explain why you chose your evidence.
Biology
1 answer:
sergiy2304 [10]3 years ago
5 0

I claim light, water and minerals are the limiting factors that might affect the growth or diversity of our ecosystem.

Abiotic factors are the non-living components of an ecosystem and include light, minerals, water etc. These are the vital components without which an ecosystem cannot exist.  

Light is essential not only for photosynthesis in plants, but also in maintaining a livable temperature on Earth. Day and night cycles affect and form all the organisms as well as the interactions between them .  

Water in itself makes possible the process of photosynthesis in plants as well as the majority of chemical processes in living organisms. Furthermore, makes possible the absorbtion of soil nutrients by the plant roots. Without water, life would not be possible.  

Minerals are trace elements that exist in all living organisms and are vital to the existance of life. They can be found in both organic and inorganic combinations and are responsible for the existance and functioning of all mental and physical processis. They are most important in maintaining all physiological process as well as acting as catalysts for many biological reactions.    

Ecosystems are complex systems that are built on complex interactions between organisms and their physical environment. In order for any life to exist, certain conditions and requirements need to be fulfilled. Among these, light, water and minerals are vital to the existance of life. Without these three, life as we know it would not be possible. They shape both the ecosystem and the organisms living in a certain area. Their abundance dictates both the growth and diversity of our ecosystem.

You might be interested in
Since the 1800’s an increase in selectively breeding dogs for human desired traits increased. How can selectively breeding dogs
alexgriva [62]

Answer:

It makes the dogs at a higher risk of health issues later on in life.

Explanation:

The dogs are usually only bred for looks. Their health is not taken into consideration.

8 0
3 years ago
_____ is the way an individual's genotype is expressed in observable and measurable characteristics.
maw [93]
Phenotype

Genotype makes up the genetic constitution of an individual. (Cannot observe with the naked eye)
6 0
3 years ago
Rust results from iron’s reaction to oxygen. An iron nail gains mass when it rusts. How does this reaction support the law of co
Leokris [45]

A

just took the test

5 0
3 years ago
Read 2 more answers
Please help quickly i will give a thanks you will get all the points and brainliest with 5 stars​
uranmaximum [27]
Might be c. Parasitism!
6 0
3 years ago
The nucleus of an atom always contains one or more?
Marrrta [24]
The nucleus always contains one or more protons.
6 0
3 years ago
Read 2 more answers
Other questions:
  • Small pea seeds move around each other but do not bounce off. What state of matter is this?
    7·1 answer
  • An ion of an element has 42 protons 44 neutrons and 43 electrons. What is it’s charge and how did you make that determination?
    10·1 answer
  • 2. How might a mutation that causes a single letter change in the DNA sequence affect
    7·1 answer
  • Materials, such as sand and rocks, are constantly being added to land masses through the process of deposition. Deposition occur
    12·1 answer
  • How does the size of the olfactory bulb in sheep compare to the size in humans? What might this tell you about the sense of smel
    13·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • In photosynthesis, what are the two major<br> reactions that take place?
    13·1 answer
  • Which statement about enzymes is true? A. An enzyme functions to increase the rate of a chemical reaction. B. Enzymes are protei
    12·1 answer
  • 12. Individuals with Type O blood are able to produce both Anti-A and Anti-B antibodies, while individuals with Type AB blood pr
    7·1 answer
  • Which one of the following observations did Darwin first make during his discovery of evolution? a. The ability of individuals t
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!