1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BartSMP [9]
3 years ago
13

1 point

Biology
1 answer:
Gala2k [10]3 years ago
7 0
Your answer would be true
You might be interested in
A population of mollusks has lived in a relatively stable environment and shown no great change in many, many years. They live,
g100num [7]
Answer choice A. Stasis.
Stasis is a block of little to no change in a species.
7 0
3 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
The result of the following cross indicates the orange eyes are _____ black eyes.
schepotkina [342]

the answer is recessive to.

7 0
3 years ago
All animals don't have red blood because they are
EastWind [94]

Answer:

The reason our blood is read is because we have iron in our blood. (Also our blood cells are red)

I think your answer is D. Red blood cells

Explanation:

Most animals do have iron in their blood so their blood is red.

But... Octopuses (yes that is the write way to say it) have copper in their blood so their blood is actually blue.

The more you know...

Hope this helped! :)

Brainliest?

6 0
3 years ago
A single codon is used to signal the beginning of protein synthesis. It is commonly called the START CODON. Locate the start cod
Artemon [7]

About the question:

You will find the chart in the attached files

Answer:

The strat codon is AUG  

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named <em>codons </em>in the mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. The total number of possible codons is 64, from which 61 codify amino acids -more than one codon codify for the same amino acid-. One of these amino acids is also the start point of protein synthesis. And the left three codons are stopping translation points.

The codons indicating the initiation or stop points during the translation process are:

  • The start codon AUG is the most common sequence used by eukaryotic cells and places near the 5´extreme of the molecule. However, other codons might be used as well. Prokaryote cells might use the codons GUG or UUG.
  • The end codons are UAA, UAG, UGA.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Can someone please answer 15-17
    14·1 answer
  • Which person probably has the highest concentration of gonadotropins in his or her bloodstream? A 6-year-old boy B 12-year-old g
    9·1 answer
  • Scientists use this word for any part of a cell enclosed by a membrane
    8·1 answer
  • I need help with my assignment!!
    10·1 answer
  • What does replication mean?
    5·2 answers
  • Which structure stores energy for the in the form of ATP?
    5·1 answer
  • 8. Look at this table and answer in which level of classification are humans and ostriches still
    14·1 answer
  • 27. Dark-colored, relatively flat regions of the Moon's surface that were formed when interior lava filled large basins
    10·2 answers
  • How many types does the larva of silkworm moult?​
    10·2 answers
  • Can DNA replicate if there are no nucleotides of one base!
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!