1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BartSMP [9]
2 years ago
13

1 point

Biology
1 answer:
Gala2k [10]2 years ago
7 0
Your answer would be true
You might be interested in
The same amino acid can be carried by different tRNA's.<br><br><br><br><br> true or false
Nataly_w [17]

The answer for this is true

4 0
3 years ago
Read 2 more answers
In the space provided, write an
Natali5045456 [20]

Answer:

Explanation:

They may have som bad side effects such as nausea, indigestion, vomiting etc. Also the bacteria change or adapt if not taken correctly so they are no longer affected by the antibiotic.

8 0
3 years ago
Read 2 more answers
Which two globin genes are most divergent from each other? what is the percent amino acid identity between them?
tiny-mole [99]

Globin 1 and globin 2 genes of insects are understood to have diverged approximately 170 million years ago, through duplication, from a common globin gene ancestor. The two genes that code for haemoglobin have conserved regions; oxygen-binding and heme- regions. Globin 2 gene has lost the intron region that is still present in the globin 1 gene. The percentage divergence is 7.2% with 20 varying nucleotides.





8 0
2 years ago
This is for science, but there isn't a subject! <br><br> To anyone who helps- thank you!
lys-0071 [83]
The grass affects the movement by helping the water not over flow / flood
3 0
3 years ago
Read 2 more answers
All of Earth's biomes and ecosystems, except the most remote, are affected by the impact that humans have made on the environmen
irina [24]

Answer:

b. False

Explanation:

All biomes, even the most remote, are affected by the impact humans have on the environment.

Humans have been causing deforestation, pollution, agricultural expansion, mining, desertification, extinction of animals and plants, burning and other practices that have had extremely negative impacts on biomes around the world. In addition, all the pollution and exploitation of nature that humans have caused has caused harmful climate change that has affected even the most remote biomes.

The biome is a large set of interconnected ecosystems. Ecosystem, in turn, is an ecological system where there is life and interaction between living beings in a given space, and can vary in size, from a puddle to a large forest.

7 0
3 years ago
Other questions:
  • Golden rice has been genetically engineered. golden rice differs from other rice varieties because it contains genes that will p
    12·2 answers
  • What part of a flowering plant becomes fruit? seed ovary stem spore
    13·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • The water table will most likely rise due to which of the following<br> processes?
    14·1 answer
  • Need help fast, please and thank you ​
    12·1 answer
  • Starting with shredded spinach leaves, you follow a procedure that separates cellular organelles into different fractions. To id
    8·1 answer
  • A cell has a defect in its receptor for growth factors, preventing growth factors from attaching to and signalling the cell. Bas
    14·1 answer
  • Which details from the text reflect the cultural context of the historical period in which Marco Polo wrote his travelogue? Chec
    13·2 answers
  • How long does it take for mitosis to complete?
    5·2 answers
  • Where does most ocean pollution come from
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!