Answer:
This question is incomplete, the options are:
A) Decreased temperature
B) Strong southerly winds
C) Presence of a predator
D) Lack of water
The answer is C
Explanation:
A stimulus is something that provokes a response or reaction in a living organism. It can either be internal or external. An animal can respond to stimulus such as hunger, heat, predator etc.
However, among all the listed stimuli in the options, the PRESENCE OF A PREDATOR is most likely to result in a more rapid heartbeat in an animal. This is because the predator stimulus will require the animal to respond by running in order to survive. Running will increase its metabolic activity and cause its heartbeat to increase.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
In the oxygen found in the molecules in the bonds between the atoms as chemical energy
Answer:
D) the sum of all physical properties of a substance