1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rasek [7]
3 years ago
8

Over time, an iron nail reacts with water to produce iron oxide, or rust. Which of the following is a signal that rusting has ta

ken place?
Chemistry
2 answers:
emmasim [6.3K]3 years ago
8 0

Explanation:

When iron reacts with the moisture present in air then an oxide layer tends to develop on the surface of iron. This process is known as rusting of iron.

Chemical formula of rust is Fe_{2}O_{3}.xH_{2}O. This layer of oxide on the surface of iron is orange-brown in color.

This change is a chemical change as a new compound iron oxide has formed in this process of rusting.

Hence, this orange-brown color on the surface of iron helps us to know that rusting has taken place.

svetlana [45]3 years ago
6 0
Answer: Chemical composition modification (or, physical signal would be color).
You might be interested in
Give the clarification of heat and temperature on the basis of molecular motion?
sdas [7]

Explanation:

Heat is a form of thermal energy.

Heat is the sum of all the energy of the molecular motion in an object.

Temperature measures the average heat possessed by each molecule in a given substance.

 Molecules at a higher temperature possess more kinetic energy and they will move faster. This kinetic energy form is the heat variant of thermal energy.

Temperature is the measure of this heat energy of molecules.

8 0
3 years ago
How many liters of C3H6O are present in a sample weighing 25.6 grams?
Romashka [77]

Answer:

V = 0.0327 L.

Explanation:

Hello there!

In this case, according to the given information, it turns out possible for us to calculate the liters of C3H6O by the definition of density. We can tell the density of this substance as that of acetone (0.784 g/mL) and therefore calculate the liters as shown below:

V=25.6g*\frac{1mL}{0.784g}*\frac{1L}{1000mL}\\\\V=0.0327L

Regards!

7 0
3 years ago
Which of the following elements is commonly found in the Earth's crust, living matter, oceans, and atmosphere? hydrogen , neon g
Svetlanka [38]

Answer: hydrogen

Explanation: hydrogen gas is a major component of water which occupies a large portion of the Earth's atmosphere

4 0
3 years ago
Please someone help ill give out the brainliest I will pleaseee just help
snow_lady [41]

Answer:

have a great time at y avg be have a great time at all today I was going to answer restroom for spring break is over and over again and again and again and again and again and again your hhhha

5 0
3 years ago
The atomic masses of the two stable isotopes of boron; boron-10 (natural abundance:19.78%) and boron-11 (natural abundance:80.22
iogann1982 [59]
(19.78 x 10) + (80.22 x 11) all of them divided by 100= 10.81 amu
5 0
3 years ago
Other questions:
  • What is the mass in grams of 1.24 mol of water
    9·1 answer
  • Refer to the periodic table of the elements to help you answer this question. if the number of protons in an electrically neutra
    10·1 answer
  • Fill in the blank:<br><br> Aspirin is a ____ of materials.
    15·1 answer
  • The Blood-Brain Barrier (BBB) is a semipermeable membrane that separates blood and the brain. Which choices below would successf
    12·1 answer
  • Which of the following methods uses the decay of atomic particles in an object to find its exact age? A. Fossil dating B. Geolog
    11·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • A sample of helium gas has a volume of 900. milliliters and a pressure of 2.50 atm at 298 K. What is the new pressure when the t
    8·1 answer
  • Which of the following statement(s) are true about the atoms of any element?
    9·1 answer
  • Which measurement is a object mass
    9·2 answers
  • Answer: D=______ Don't forget the units! *
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!