1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OlgaM077 [116]
2 years ago
14

In what order does protein production occur in a cell 

Biology
1 answer:
Illusion [34]2 years ago
4 0

Explanation:

Protein synthesis is the process in which cells make proteins. It occurs in two stages: transcription and translation. Transcription is the transfer of genetic instructions in DNA to mRNA in the nucleus. It includes three steps: initiation, elongation, and termination

You might be interested in
What remind’s you of the ribosomes in a cell???<br> Plz help due today!!
rewona [7]

Answer:

i imagine them as peopel in a big city, or animals in the wild with predators that are hungry, the cell uses the ribosomes for food and to heal the cell with energy.

Explanation:

8 0
3 years ago
Read 2 more answers
What come first a chicken or the egg?
bazaltina [42]
Egg cause thingsnwere laying eggs before chickens were. and first chicken was a genetic mutation.
3 0
3 years ago
Read 2 more answers
What are the appendages of a sea anenome called?
Natasha2012 [34]
They have their tentacles which house cells called<span> cnidocytes.</span>
6 0
2 years ago
Macrophages digest the invading bacteria and viruses with the digestive enzymes found in cellular organelles called
Nataly_w [17]
Lysozyme which is found in the lysosomes. They function at a relatively low pH and are so because if they functioned at physiological pH they would digest the cell. But in this case, they are in the lysosomes where they are safe and at a lower pH so when the vesicles open they can emit hydrogen ions and the lysozyme to digest the foreign material.
6 0
3 years ago
The above pictures show the interaction of pollinators (like insects, birds, and bats)
malfutka [58]

Answer:

The pollinators help spread the pollen of the flowering plants to help them reproduce. If the flowering plants blended into their surroundings, the pollinators would not be able to identify the flowering plants, and the plants would eventually die off or become extinct.

Explanation:

6 0
2 years ago
Other questions:
  • Plants that have many seasons of reproduction are called ____.
    9·2 answers
  • How does the atmosphere make conditions on Earth suitable for living things?
    9·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Match each atom to the corresponding number of electrons it will steal or give away.
    6·1 answer
  • How do we know the frequency of a wave when we can't see it?
    12·1 answer
  • Do Meiosis and Mitosis occur in all organisms?
    9·1 answer
  • Tetanus patients exhibit ________ when muscle spasms causes them to arch their backs.
    7·1 answer
  • What term refers to the gene that is expressed when two different genes for a trait are present in a gene pair?
    15·1 answer
  • What is the remaining ratio of alleles if my total is 140 and 65.8% are red and 18.2% are blue?
    12·2 answers
  • What protein is faulty in sickle cell anemia?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!