How do pain relievers work?

2 answers:

7 0

I believe the answer is is that it blocks messages within the nervous system, because pain is perceived in the brain through messages sent from the nervous system.

uranmaximum [27]4 years ago

5 0

Answer:

The correct answer is option C, block messages within the nervous system

Explanation:

Whenever our body gets injured, the damaged cells in it releases a chemical known as “prostaglandin” which sends pain signals through the nerves to the brain. Now when a pain reliever is injected in the body, it stops the production of prostaglandin. As the chemical production stops, no pain messages are send to the brain and thus the pain goes away

You might be interested in

Carbon dioxide enters the atmosphere by animal and human ___ and the burning of ____.

Nadya [2.5K]

The correct answer that would best complete the given statement above would be CELL RESPIRATION and FOSSIL FUELS. Carbon dioxide enters the atmosphere by animal and human cell respiration and the burning of fossil fuels. Human activities such as BURNING FOSSIL FUELS and RESPIRATION cycle carbon through the carbon cycle. Hope this is the answer that you are looking for.

6 0

3 years ago

Most animals living in the _________ rest during the day and are more active at night.

jolli1 [7]

Answer:

desert

Explanation:

4 0

3 years ago

1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0

3 years ago

The control and experimental groups are designed to be identical<br><br> True or false

NARA [144]

False would be your answer

4 0

4 years ago

Read 2 more answers

How s a mixture different than a compound

OleMash [197]

Compound: two or more different atoms chemically bonded together. Molecule: two or more different or same atoms chemically bonded together. A mixture: contains two or more substances that are not chemically bonded together Hope this helps!!!!!!

5 0

3 years ago