1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
loris [4]
3 years ago
13

In E. coli, the enzyme hexokinase catalyzes the reaction: Glucose + ATP → glucose 6-phosphate + ADP The equilibrium constant, Ke

q, is 7.8 x 102. In the living E. coli cells, [ATP] = 7.9 mM; [ADP] = 1.04 mM, [glucose] = 2 mM, [glucose 6-phosphate] = 1 mM. Determine if the reaction is at equilibrium. If the reaction is not at equilibrium, determine which side the reaction favors in living E. coli cells.
Chemistry
1 answer:
kondor19780726 [428]3 years ago
4 0

Answer:

Explanation:

Glucose + ATP → glucose 6-phosphate + ADP The equilibrium constant, Keq, is 7.8 x 102.

In the living E. coli cells,

[ATP] = 7.9 mM;

[ADP] = 1.04 mM,

[glucose] = 2 mM,

[glucose 6-phosphate] = 1 mM.

Determine if the reaction is at equilibrium. If the reaction is not at equilibrium, determine which side the reaction favors in living E. coli cells.

The reaction is given as

Glucose + ATP → glucose 6-phosphate + ADP

Now reaction quotient for given equation above is

q=\frac{[\text {glucose 6-phosphate}][ADP]}{[Glucose][ATP]}

q=\frac{(1mm)\times (1.04 mm)}{(7.9mm)\times (2mm)} \\\\=6.582\times 10^{-2}

so,

q ⇒ following this criteria the reaction will go towards the right direction ( that is forward reaction is favorable  until q = Keq

You might be interested in
. Using the pH scale below what would be the pH value of an Acid? *
earnstyle [38]

Answer : The pH value of an acid is below 7.

Explanation :

pH : It is defined as the negative logarithm of hydrogen ion or hydronium ion concentration.

Mathematically,

pH=-\log [H^+]

When the pH less than 7 then the solution is acidic and the concentration of hydrogen ion is greater than hydroxide ion.

When the pH more than 7 then the solution is basic and the concentration of hydrogen ion is less than hydroxide ion.

When the pH is equal to 7 then the solution is neutral and the concentration of hydrogen ion is equal to the hydroxide ion.

Hence, the pH value of an acid is below 7.

6 0
3 years ago
Define Acid and alkalis​
kicyunya [14]

Answer:

Acids have a pH less than 7. Acids contain lots of hydrogen ions

Alkalis have a pH greater than 7. Alkalis contain lots of hydroxide ions

<u><em></em></u>

<u><em>Please mark as brainliest if answer is right </em></u>

Have a great day, be safe and healthy  

Thank u  

XD

7 0
2 years ago
Read 2 more answers
If m = 45g and V = 15ml, what is D in g/ml?​
ch4aika [34]

Answer:

3 g/mL

Explanation:

We know that the density of an object can be measured by dividing its mass (g) to its volume (mL).

Formula

D=m/v

Given data:

Mass= 45 g

Volume= 15 mL

Now we will put the values in formula:

D=45 g/ 15 mL= 3 g/mL

6 0
3 years ago
Ion arrangements of three general salts are represented below. h5sil917 h5sil917021 h5sil91703 which ion arrangement has the hig
vovangra [49]
This question is incomplete. Luckily, I found the same problem which is shown in the attached picture. To answer the question, we must know how the size and charge affect the lattice energy. The answer is: lattice energy increases with the increasing charge of the ions, and decreasing radius of the atoms. <em>Therefore, the ranking would be: A < B < C</em>.

4 0
3 years ago
If f(x)=x^2 and g(x)=2x+3, what is f(g(x))
IgorC [24]

Answer:

\huge\boxed{f(g(x)) = 4x^2 + 12x + 9}

Explanation:

In its raw form, function notation essentially represents an equation with only one unknown variable, expressed in terms of another.  Thus, f(x) = x² + 7x can be expressed as

g(x) = 2x + 3

f(g(x)) = (2x + 3)²

f(g(x)) = 4x² + 12x + 9

Hope it helps :) and let me know if you want me to elaborate.

6 0
2 years ago
Read 2 more answers
Other questions:
  • Which subatomic particle is electrically neutral and found in the nucleus of an atom?
    5·2 answers
  • Consider the n = 3 energy level in a hydrogen atom. how many electrons can be placed in this level?
    5·2 answers
  • What is physical and chemical change ?
    7·1 answer
  • What might happen to the sickle-cell mutation if malaria in Africa were eliminated?
    13·1 answer
  • Write two solubility rules that are used in this lab
    15·1 answer
  • What are the electrons capable of Sharing accepting or donating called?
    8·1 answer
  • Which explanation correctly describes why it is important for a cell’s surface-area-to-volume ratio to not be too small?
    13·1 answer
  • The reason that it is (mostly) correct to generalize that ionic bonds will form between a metal and a nonmetal is that _____.
    13·1 answer
  • Magnesium (24.30g) reacts with hydrogen chloride (xg) to produce hydrogen gas(2.04g) and magnesium chloride (96.90g). How much h
    12·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!