1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
guajiro [1.7K]
3 years ago
5

Why must living things rely on thousands of catalysts for chemical reactions necessary for life?

Chemistry
2 answers:
kkurt [141]3 years ago
8 0
To produce energy and food
Murrr4er [49]3 years ago
7 0
Well, you don't need enzymes (biological catalysts) if you're willing to wait a century or two to digest a burger.

Without catalysts, complex reactions like digestion would take too long and the organism could not extract energy from the nutrients it eats in a practical time frame.

In addition, speed is everything in the biological world.

Some reactions and their speed relative to other organisms reactions determines who survives and who doesn't, among other aspects of life.

If a plant is slow to photosynthesize and grow in a habitat high in competition for sunlight real estate, other autotrophs will surely take over.
You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
If a substance undergoes electrolysis and a brown solid forms on one electrode and a gas on the other, from this we can conclude
andrew-mc [135]

Answer:

b. a compound.

Explanation:

Electrolysis is described as a mechanism in which ionic compounds are decomposed into their elements by transmitting a direct electric current via the compound in a liquid state. At the cathode, the cations are reduced and anions at the anode are oxidized. There is an exchange between ions and atoms in the electrolysis process caused by the addition or removal between electrons from the external circuit. As per the question, the original substance is a compound because the electrolysis method is used to obtain pure elements from their respective compound.

7 0
3 years ago
Classify each of the following reactions when only the reactants are given and fill in the products.
Nadya [2.5K]

Answer:

CO2 + MgO

Explanation:

We want the number of each element on the Reactants (Left side) to be equal to the number of each element on the Product side (Right side).

3 0
3 years ago
What is 11/6 + 11/6 in fractions
Andreyy89
3 2/3 is your answer
6 0
3 years ago
Read 2 more answers
What type of reaction is this?—- Large Compound=Element A+Element B
Sav [38]
This reaction is decomposition. It is the breakdown of a compound into simpler and smaller elements.
6 0
3 years ago
Other questions:
  • What would happen to the following endothermic reaction that is in equilibrium if heat is added? N2O4 (g) Two arrows stacked on
    9·2 answers
  • Which substance has the lowest boiling point?
    6·2 answers
  • What type of gloves protects your hands from heat and flames?
    5·2 answers
  • jake pushes a heavy box across a carpeted floor.Name three forces that act on the box, and explain how you know these are unbale
    11·1 answer
  • A Chemical Reactions Takes Place When
    6·2 answers
  • Which is the electron configuration for bromine?
    10·1 answer
  • Which statement best describes SARS? SARS was an epidemic, but not a pandemic. SARS was a pandemic, but not an epidemic. SARS wa
    6·2 answers
  • Some animals migrate, or seasonally move to a different place. In some bird populations, such as Canada geese, some birds migrat
    7·1 answer
  • What type of weathering involves changes in the size or shape of the rock?
    15·1 answer
  • you have a sample of.neon gas that you want to use to.make a glowing sign. you investigate that the gas sample is at 45c and has
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!