1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ElenaW [278]
3 years ago
7

Explain the differences between acids and bases. Provide examples.

Biology
1 answer:
Pachacha [2.7K]3 years ago
3 0

Answer:

An acid increases the concentration of H+ ions. A base is a substance that releases hydroxide (OH-) ions in aqueous solution, donates electrons and accepts protons.

Acid:Lemons, oranges, vinegar

Base:Soap, toothpaste, bleach, cleaning agents, limewater,

Explanation:

You might be interested in
Match the organelle to its function-
daser333 [38]

Answer:

I seriously do not understand, you clearly know the answers.  You put all of the correct matchings on your assignment.  Are you trying to give free points?  I am literally so confuse.  Thank you for the free points, and hope you have a bless day.

Explanation:

7 0
3 years ago
Why was soil in wheat farms so much more vulnerable to erosion?
erica [24]

Explanation: The potential soil erosion increases if the soil has no or very little vegetative cover of plants/grass and/or crop residues. Plant and residue cover protects the soil from rain impact and splashes from it. It tends to slow down the movement of runoff water and allows excess surface water to infiltrate.

I hope this helps you! Have a nice day or night!!

5 0
2 years ago
removing seeds from cotton plants was a slow job until eli whitney invented the cotton gin what is cotton gin
Fudgin [204]
A mechanic invented by eli whitney that removes seeds from cotton much more more quickly and effectively than by hand.
8 0
2 years ago
How many MYA was the mass extinction of dinosaurs, ammonoids, and many land plants?
ira [324]
The Cretaceous–Paleogene (K–Pg) extinction event (also known as the Cretaceous–Tertiary (K–T) extinction) was a sudden mass extinction of three-quarters of the plant and animal species on Earth, approximately 66 million years ago.
6 0
3 years ago
Choose all the answers that apply. Chronic diseases _____. can be prevented through immunization can be spread from one person t
ehidna [41]

Answer:

If I recall from my class that it healthy life sytle and may be prevented through immunization I don't remember which but i know its maintain a healthy life style  

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • When planning care for a cardiac patient, the nurse knows that in response to an increased workload, cardiac myocardial cells wi
    9·1 answer
  • Name three examples of stimuli
    12·1 answer
  • A red blood cell has been placed into three different solutions. one solution is isotonic to the cell, one solution is hypotonic
    10·1 answer
  • The dorsal body cavity is divided into which two cavities?
    11·1 answer
  • Coal is formed when layers of plant matter accumulate at the bottom of a body of water and are protected from biodegradation and
    11·1 answer
  • What complex compounds produced by living organisms called
    7·1 answer
  • Which region of your brainstem plays a role in arousing you to a state of alertness when, for example, you accidentally stumble
    15·1 answer
  • Nutrients are needed for: a.cells to produce proteins and other bio chemicals b. Animals to build shells and skeletons c. Plant
    8·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • I hope you can help me <3
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!