1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pychu [463]
2 years ago
13

The photos shown below illustrate a case of synpolydactyly, a genetic abnormality characterized by two phenotypes: partially or

completely duplicated fingers or toes, and webbing between fingers or toes. The same mutations that give rise to the human phenotype also give rise to a similar phenotype in mice. In which family of genes do you think these mutations occur?
Biology
1 answer:
musickatia [10]2 years ago
5 0

Answer:

Hox gene complex is the set of genes responsible for maintaining the basic body plan of an organism. Synpolydactyly syndrome was the first disorder discovered in human beings that resulted from the mutation in the Hox gene complex. As a result of mutations in the Hox gene complex, syndactyly is inherited, which results in the fusion of fourth and fifth toes and third and fourth fingers.

hope it helps:)

You might be interested in
When pathogens are ingested and then multiply in the body, it is known as _____.
VMariaS [17]
A - Food-Born Illness
7 0
3 years ago
Read 2 more answers
What di eukaryotes most likely evolve from?
otez555 [7]

Answer:

Prokaryotes.

Explanation:

Most of the Eukaryotes most likely to evolve from the Prokaryotes.  Prokaryotes are basically unicellular organisms that lack internal membrane-bound structures. So, they do not carry nucleus and generally have a single chromosome. Most of them have a cell wall outside  the plasma membrane, which is a thin layer of lipid that completely surrounds the cell.  Prokaryotes reproduce by binary fission method.

8 0
2 years ago
As a final exam question in your biology course, you are asked to identify an animal that you immediately recognize as a chordat
julia-pushkina [17]

Answer: c) and b) are correct.

The brain is encased in a protective bony or cartilaginous housing in craniates.

The anterior end of the nerve cord is elaborated to form a brain in craniates.

Explanation: The craniates include the chordata with well-defined heads. This includes mammals, reptiles and fishes. So we can discard the other answers. Because most craniates have functional jaws, and the adults do not lose their chordate characteristics. The last one does not apply as a specific feature because the tunicate have neural crest but are not recognized as craniata.

8 0
3 years ago
Read 2 more answers
How do fishermen exploit seafood on the Mississippi River? Help me now, 10 points for you :(
aleksandrvk [35]

It's safe to eat the fish there,” says Langley.So according to officials and experts, it is safe to eat that Mississippi River catfish.

5 0
3 years ago
Give one real life example of an enzymatic reaction in the human body.
son4ous [18]

Answer:

Enzymes are the bio-catalyst produced by the body.

They increases the rate of bio-chemicals reaction taking inside the body.

They form enzyme-substrate complex in order to increase the rate of the reaction.

They are highly specific in nature.

Example:
  • Hexokinase catalyses the conversion of glucose to glucose-6-phosphate.
  • Salivary amylase catalyses the breakdown of starch into maltose (simpler sachharides).
  • Protein kinase is an enzyme used to activate or deactivate other by adding phosphate group to them.
5 0
3 years ago
Other questions:
  • Substances that are sour in taste​
    14·1 answer
  • Which of the following correctly organizes these specific terms in order from smallest to largest?
    8·2 answers
  • You eat a bowl of beans as part of vour dinner. As vou digest the beans, the proteins that are present get broken down to their
    6·1 answer
  • How can blood grouping be used in paternity testing
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • When patients who are receiving glucocorticoid therapy (for example, with prednisone) need to stop taking it, the doctor will pr
    11·1 answer
  • A team of scientists mapped a forest where orangutans live in a national park
    13·2 answers
  • Please help! 10 points and brainliest!!
    8·1 answer
  • Any TWO mineral elements that are required for the formation of<br>proteins<br>​
    11·1 answer
  • Would an enzyme work in a different environment that is used to?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!