1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kondor19780726 [428]
3 years ago
8

What travels through a food chain or web ?

Biology
1 answer:
Tresset [83]3 years ago
6 0

The arrows in a food chain show the flow of energy, from the sun or hydrothermal vent to a top predator. As the energy flows from organism to organism, energy is lost at each step. A network of many food chains is called a food web. ... The trophic level of an organism is the position it holds in a food chain

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Which component of the earth's atmosphere is decreased due to photosynthesis?
Kobotan [32]
It would be Carbon Dioxide.
4 0
3 years ago
Which statement correctly describes the rock cycle?
Ede4ka [16]
I’m pretty sure it’s D, the others don’t make sense??
6 0
2 years ago
The restriction enzymes that cut the bacteriophage DNA cannot cut the bacterial chromosomal DNA. Explain this statement. The bac
Crazy boy [7]
"<span>The bacteria can cut the viral DNA at its specific restriction site but protect their own chromosomal DNA by modifying its bases and blocking the restriction enzyme" is the one explanation to the statement given in question. The correct option among all the options that are given in the question is the second option.</span>
7 0
3 years ago
Read 2 more answers
What are two ways in which waves erode the land?
sashaice [31]

i believe the answer is Abrasion and Impact. Hope this helps :-)

7 0
3 years ago
Other questions:
  • Which of the following adaptations does not help an animal move through the water
    7·1 answer
  • Question 13.
    14·1 answer
  • Fermentation is carried out regularly, and not only during oxygen emergencies, by what organisms?
    11·2 answers
  • tarah built a model that shows how the skeletal and muscular systems allow the human arm to bend. she used two wooden planks, a
    15·1 answer
  • Having trouble with this textbook question. Can anyone help me out?
    15·1 answer
  • Invasive species are harmful not because of what they are, but because of
    7·1 answer
  • Help is needed for this question plz
    5·2 answers
  • Sucrose (table sugar) is a disaccharide of glucose and fructose. Fructose (one of the products) is much sweeter than sucrose (th
    6·1 answer
  • The volume enclosed by the plasma membrane of plant cells is often much larger than the corresponding volume in animal cells. Th
    8·1 answer
  • WRAP-UP
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!