1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
netineya [11]
4 years ago
8

Is there a scientific reason why adults don't really understand their children?

Biology
1 answer:
Alenkinab [10]4 years ago
8 0
Throughout their teenage years, children's minds are literally being rewired. Teenagers are unable to comprehend facial expressions or other's emotions which can make it for others to understand them or for them to even understand themselves.
You might be interested in
Why does water have a high specific heat
Marat540 [252]

Answer:

Water's high heat capacity is a property caused by hydrogen bonding among water molecules. ... When the temperature of water decreases, the hydrogen bonds are formed and release a considerable amount of energy. Water has the highest specific heat capacity of any liquid.

Explanation:

7 0
3 years ago
Which organelle modifies cell products, packages them for distribution, and then may turn into vesicles and bubble off the surfa
hram777 [196]
The Golgi Apparatus does this
8 0
4 years ago
Read 2 more answers
What are alleles mutations in the dna
Papessa [141]

Answer:

Mutations Are Recessive or Dominant

7 0
3 years ago
You have learned that mutations can occur in dna sequences. are all mutations deadly?
Monica [59]
No, the vast majority of DNA mutations are not physically noticeable, and those that are noticeable physically are mainly cosmetic differences, such as a change in hair color, or heterochromia. 
3 0
3 years ago
An element's atomic number is 18. How many protons would an atom of this element have? _______ protons
Ne4ueva [31]
It would have 18 protons
4 0
3 years ago
Read 2 more answers
Other questions:
  • In Linnaeus's system of classifying organisms, orders are grouped together into:A.classes.
    14·1 answer
  • ____ is a type of cell division that produces gametes
    6·2 answers
  • The purpose of plasmodesmata is to _____.
    15·2 answers
  • Which statement best describes how enzymes function in the body?
    5·2 answers
  • How can you lift an elephant with one hand? <br> If you can answer this you can be the brainliest!
    11·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • List two behavioral adaptations that Darwin observed.
    5·1 answer
  • Which are the functions of proteins?
    8·1 answer
  • An electrocardiogram (ECG) provides information about: Group of answer choices the pressure of blood in the heart chambers the r
    10·1 answer
  • What does a J-shaped curve demonstrate for population growth?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!