1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sertanlavr [38]
3 years ago
6

Lipids differ from other large biological molecules in that they _____.

Biology
1 answer:
stiv31 [10]3 years ago
3 0

Answer:

Have a nonpolar nature

Explanation:

Organic molecules are composed of carbon and hydrogen, they're divided into four major classes: proteins, nucleic acids, carbohydrates, and lipids. <em>Lipids are divided into two categories:</em>

  • Long chains of carbon atoms accompanied by hydrogen atoms, such as fatty acids
  • Molecules in which carbon atoms are attached as multiple ring structures that are fused, such as cholesterol.

Both kinds of lipids share an important behavior, they don't readily dissolve in water, but they are soluble in many organic solvents. This is related to their polarity, the electrons in lipids are distributed unevenly creating a molecule that can have a partial positive charge and another part with a partial negative charge.

I hope you find this information useful and interesting! Good luck!

You might be interested in
3 alternative energy sources
yarga [219]
2. sun, wind, rain
i think it’s that
8 0
3 years ago
You are on vacation with your family up in the mountains. Your friend is on vacation near the equator by the ocean. Explain whic
Lelu [443]

Answer:

In the mountains

Explanation:

because its hotter near the equater and it doesnt get that much rain unlike up in the mountains

7 0
3 years ago
which of the following make acid rain A.carbon dioxide and sulphur monoxide B.carbon dioxide and sulphur dioxide C.carbon monoxi
uysha [10]

Answer:

b.carbon dioxide and sulphur dioxide

5 0
3 years ago
During the investigation of a murder case, the police found a few bloodstains on the body of the victim, a few bloodstains on th
ValentinkaMS [17]

Answer:

C

Explanation:

5 0
4 years ago
Determine tRNA anticodons<br> UACCUGUUAAGCUACAAAAUU
Pavel [41]

Answer:

i dont know sorry , Gooqle it

7 0
3 years ago
Other questions:
  • What step has not yet been accomplished by scientists researching the origin of life on Earth?
    6·1 answer
  • Which of the following is NOT a
    11·2 answers
  • What impact did the boycotts and protests have on savannah, Georgia?
    15·1 answer
  • 3. A breeder wants to mate a
    12·1 answer
  • Why can the complex sugar cellulose store more energy than the sugar glucose?
    7·1 answer
  • Which stores groundwater?
    7·1 answer
  • What type of map is most useful for a person hiking<br>along the Appalachian Trail?​
    6·1 answer
  • Enzymes often
    9·1 answer
  • If guanine replaces with cytosine in erd codon of gene 4, what will happen to the organism <br> ​
    8·1 answer
  • USE PICTURE ABOVE!! NEED ANSWERS ASAP!!! 8. Categorize What types of bonds are present in
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!