1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Llana [10]
3 years ago
7

Which amino acid chain will be formed by the codons shown below?

Biology
1 answer:
oee [108]3 years ago
5 0

Answer:

the answer is d. lys-arg-cys

You might be interested in
B?
prisoha [69]
No, it's not B. The energy needed to "pump" sodium outside the cell in active transport is ATP. When ATP releases energy (for metabolism usage) during active transport, the sodium is discarded.
6 0
4 years ago
The eye, heart in skin of a pig, and a leaf from an oak tree are all examples of_______. They are groups of tissues join togeth
Mazyrski [523]

Answer:

it should be organ .....

8 0
3 years ago
Which of the following is true regarding cultivation and isolation of animal viruses? View Available Hint(s) Which of the follow
Studentka2010 [4]

completed question'

.....culturing viruses that requires a human host

Answer:

Diploid cell culture lines, developed from human embryos, are widely used for culturing viruses that require a human host

Explanation

Viruses can not thrive in a non-living host or artificial media.They  are intracelular parasites  which needed living host to replicate . Cultures lines from Human embryo  in are therefore used for culturing viruses of human host, so that its mode of replication and gene expression can be studied, and therefore its virulence can easily be studied.

This method have the advantage that;

1.there is no need to make use of the whole animal rather,on a tiny tissue needed can be isolated for culture.

2. the cells growth is continuous,and can be preserved in liquid Nitrogen and renew for future culture

3. cells can be grown in different containers,  with ability to decide the number of cells needed.

Temperature is kept at optimum for human in the culture at  37 degree centigrade, nutrients are provided, NaHC03 as buffers for C02, and  the medium is humidified.

3 0
3 years ago
What is the general characteristics of fungi
77julia77 [94]
Fungi includes mushrooms, yeast, and mold. Fungi are multicellular and eukaryotic. They are also heterotrophs, and gain nutrition through adsorption
3 0
3 years ago
From deep to superficial, the order of the strata of the epidermis is corneum - granulosum - lucidum - spinosum - basale. spinos
kotykmax [81]

Answer:

basale - spinosum - granulosum - lucidum - corneum.  

Explanation:

The order of strata in the epidermis:

  • Basale: it is the deepest stratum. It has one layer of cells called keratinocytes, which are stem cells for the epidermis.
  • Spinosum: The keratinocytes in this layer have spiny shapes. They synthesize cytokeratin and lipids. In this layer, we can also find macrophages.
  • Granulosum: The keratinocytes of the previous layer ascend and synthesize keratohyalin, which is in granules. The keratohyalin helps to join keratin filaments. Also, the cells release the lipids synthesized in the previous layer, and they form a barrier that stops dehydration.
  • Lucidum: it is only on thick skin, like the one in the sole of the feet. The keratinocytes in this layer have expelled the nucleus and now are dead cells. The keratinocytes have a flat shape and form a thin layer.
  • Corneum: it is the most superficial layer. It is made of dead keratinocytes filled with keratin in their cytoplasm. It is a thick layer that suffers desquamation when new dead cells filled with keratin ascend from the previous layer.

4 0
3 years ago
Other questions:
  • Limestone is an example of _____.
    15·2 answers
  • Biology helpp please,, tysm !! <br> reward is 10 points
    8·2 answers
  • In a lysogenic infection the viral DNA that is embedded in a host cells DNA is called
    8·2 answers
  • *Psychology*
    14·2 answers
  • Compare the properties of the parent and daughter cells in mitosis and meiosis and explain the reason for any differences. it ne
    5·1 answer
  • Which medical conditions are associated with large amounts of fat and sugar in your diet? Select three options.
    14·1 answer
  • Which of the following describes research that would be considered basic science? A. A professor at a university is observing th
    13·1 answer
  • Which stage of the cell cycle happens directly after cytokinesis?
    13·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Which statements always apply to the process of diffusion? Check all that apply.
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!