1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NARA [144]
2 years ago
12

At a given temperature, 4.06 atm of H2 and 3.5 atm of Cl2 are mixed and allowed to come to equilibrium. The equilibrium pressure

of HCl is found to be 1.418 atm. Calculate Kp for the reaction at this temperature. H2(g) + Cl2(g) <=> 2 HCl(g)
Chemistry
1 answer:
Llana [10]2 years ago
5 0

<u>Answer:</u> The value of K_p for the given chemical reaction is 0.1415

<u>Explanation:</u>

Equilibrium constant in terms of partial pressure is defined as the ratio of partial pressures of the products and the reactants each raised to the power their stoichiometric ratios. It is expressed as K_p

For a general chemical reaction:

aA+bB\rightarrow cC+dD

The expression for K_p is written as:

K_p=\frac{p_{C}^cp_{D}^d}{p_{A}^ap_{B}^b}

For the given chemical equation:

H_2(g)+Cl_2(g)\rightleftharpoons 2HCl(g)

The expression for K_p for the following equation is:

K_p=\frac{(p_{HCl})^2}{(p_{H_2)}(p_{Cl_2})}

We are given:

p_{HCl}=1.418atm\\p_{H_2}=4.06atm\\p_{Cl_2}=3.5atm

Putting values in above equation, we get:

K_p=\frac{(1.418)^2}{(4.06)\times (3.5)}\\\\K_p=0.1415

The value of K_p for the given chemical reaction is 0.1415

You might be interested in
Which of the following would be expected to have the highest viscosity? CH3CH2OH, HOCH2OH, CH3CH2CH3
zaharov [31]

Answer: Out of the given options HOCH_{2}OH is expected to have the highest viscosity.

Explanation:

The resistance occurred in the flow of a liquid substance is called viscosity.

More stronger is the intermolecular forces present in a substance more will be its resistance in its flow. Hence, more will be its viscosity.

For example,  HOCH_{2}OH has strong intermolecular hydrogen bonding than the one's present in CH_{3}CH_{2}OH and CH_{3}CH_{2}CH_{3}. This is because two-OH groups are present over here.

Thus, we can conclude that out of the given options HOCH_{2}OH is expected to have the highest viscosity.

5 0
2 years ago
My question is what is a cell?
frez [133]

The smallest functional and structural unit of an organism, usually microscopic and consisting of cytoplasm and a nucleus in a membrane.

5 0
3 years ago
Someone help me out with these chemistry (stoichiometry)
lana66690 [7]

Answer:Videos

For example, when oxygen and hydrogen react to produce water, one mole of oxygen ... These conversion factors state the ratio of reactants that react but do not tell ... In a typical chemical equation, an arrow separates the reactants on the left ... For example, to determine the number of mol

6 0
3 years ago
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
How many chlorine atoms are there in one molecule of PCI3
Darya [45]

Answer:

Chemical Formula:

For example- for every one mole of the compound PCl3 P C l 3 , it contains 3 moles of Chlorine atom and 1 mole of Phosphorus atom.

Explanation:

• Phosphorus trichloride (PCl3) contains three chlorine atoms and one phosphorus atoms.

8 0
1 year ago
Other questions:
  • Which best explains why scientific theories grow stronger over time? (2 points)
    13·1 answer
  • A student mixes a spoonful of sugar into a glass of water and stirs until the sugar dissolves completely. Match each substance t
    15·1 answer
  • If a DNA molecule is found to be made of 40% thymine,What percentage guanine would you expect
    7·1 answer
  • The equation, H2SO4 (aq) + Sr(OH)2 (aq) arrow SrSO4 (aq) + H2O (l), represents what?
    6·2 answers
  • What isotope has 13 protons and 14 neutrons? enter the name of the element followed by a hyphen and the mass number (e.g., urani
    8·1 answer
  • What element is used in making thermometers
    13·2 answers
  • 1. Why don't the elements neon and argon react with other elements to form<br> compounds?
    7·1 answer
  • An acorn falls from a tree.Which of the following statements is true?
    8·2 answers
  • 6/14and3/7 answer 6/11and9/16answer 5:6=10:12answer​
    14·1 answer
  • .What type of energy includes both kinetic and potential energy?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!