Answer: Out of the given options
is expected to have the highest viscosity.
Explanation:
The resistance occurred in the flow of a liquid substance is called viscosity.
More stronger is the intermolecular forces present in a substance more will be its resistance in its flow. Hence, more will be its viscosity.
For example,
has strong intermolecular hydrogen bonding than the one's present in
and
. This is because two-OH groups are present over here.
Thus, we can conclude that out of the given options
is expected to have the highest viscosity.
The smallest functional and structural unit of an organism, usually microscopic and consisting of cytoplasm and a nucleus in a membrane.
Answer:Videos
For example, when oxygen and hydrogen react to produce water, one mole of oxygen ... These conversion factors state the ratio of reactants that react but do not tell ... In a typical chemical equation, an arrow separates the reactants on the left ... For example, to determine the number of mol
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
Chemical Formula:
For example- for every one mole of the compound PCl3 P C l 3 , it contains 3 moles of Chlorine atom and 1 mole of Phosphorus atom.
Explanation:
• Phosphorus trichloride (PCl3) contains three chlorine atoms and one phosphorus atoms.