1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Usimov [2.4K]
3 years ago
12

What disease is caused by this plasmodium which is transmitted through the bite of female mosquito? 2 points CHOLERA B. DENGUE C

. MALARIA D. SLEEPING SICKNESS
Biology
1 answer:
fenix001 [56]3 years ago
6 0

Answer:

C. Malaria

Explanation:

Malaria is caused by Plasmodium parasites. The parasites are spread to people through the bites of infected female Anopheles mosquitoes, called "malaria vectors."

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Which activity causes the least amount of wetland and estuary degradation when it occurs near the coast?
krek1111 [17]

Answer:

The activity which causes the least amount of wetland and estuary degradation when it occurs near the coast is:

A. dune grass rehabilitation

Explanation:

This is actually a rehabilitation effort, unlike the other three options that cause land degradation.  A dune grass rehabilitation accretes sand and minimizes the rates of beach erosion. The program tries to protect coastal infrastructure and upland properties from storm damage by planting vegetation, fencing off sensitive areas, blocking storm surge, creating dune walkways, and absorbing wave energy.  During dune grass rehabilitation, activities that adversely affect the dunes are avoided.

4 0
2 years ago
A video game console manufacturer hired scientists and engineers to work on ways to improve the video cards used in their game s
Alex777 [14]

Answer: To obtain superior innovation

Explanation:

The company in other to be perceived above and to be preferred above their rivals, they are to create an innovation that is higher in quality and superiority to other game systems in other organisations

7 0
3 years ago
Why might humans purposefully cause disturbances in an ecosystem? Explain
irina1246 [14]

Alot of humans might not now they are even harming the systems by smoking or littering.

8 0
3 years ago
In what type of cells is smooth er abundant
Temka [501]
I think the answer is Specialized cells!
7 0
3 years ago
Other questions:
  • Because they lack well-defined and complex organ systems, we hypothesize that _____ diverged from all other animals early in the
    10·1 answer
  • What is the error in this experiment please ??
    10·1 answer
  • If the frequency of the recessive allele for a gene is 0.3, calculate the expected frequency of heterozygotes in the next genera
    15·1 answer
  • What is one way that cancer can form?
    11·2 answers
  • Multiple Choice
    12·2 answers
  • WILL GIVE BRAINLIEST!!!!!
    7·2 answers
  • Why was the discovery of DNA important to our daily lives?
    13·1 answer
  • How did the carbon atom get from land animals back to the atmosphere? Animals and plants need to get rid of carbon dioxide gas t
    5·1 answer
  • Please help me you are a godsvaer
    7·1 answer
  • In which organism would photosynthesis not occur?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!