1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
charle [14.2K]
3 years ago
7

Indicate, as true or false, whether each of the following statements about species is a component of the biological species conc

ept.
A. Their reproductive isolation from each other is complete.
B. They are unable to produce hybrid offspring upon interbreeding.
C. They shared a common ancestor recently in evolutionary time.
Biology
1 answer:
adell [148]3 years ago
3 0

Their reproductive isolation from each other is complete: False  

They are unable to produce hybrid offspring upon interbreeding: True  

They shared a common ancestor recently in evolutionary time: False  

Explanation:

A species known as a group of that organisms which can be potentially interbreed with another one to produce viable, fertile offspring. Prezygotic and postzygotic barriers separated the species from each other. It prevents the mating of viable fertile offspring.  

This process happens when groups in that species become reproductively diverge as well as isolated. In the formation of new species postzygotic and Prezygotic barriers play vital role.  

You might be interested in
Water has a high specific heat, meaning that water will warm up or cool down more
laila [671]
Cool down more...................
4 0
3 years ago
Water shape creates a positive and negative side to it. This shape then creates what characteristics of water?
miskamm [114]
D high specific heat
3 0
3 years ago
A watershed can best be defined as a body of water where water collects overtime.
strojnjashka [21]
False a watershed is an area of land that contains a common set of streams and rivers that all drain into a single larger body of water
8 0
2 years ago
Read 2 more answers
Which of the following is not the name of an air mass?
Nadya [2.5K]
That would be A. tepid moist
Hope I helped!
5 0
2 years ago
What’s the answer to this??
olga55 [171]

I think it’s 12 but i’m not 100% sure.
6 0
3 years ago
Read 2 more answers
Other questions:
  • The driving force behind gas exchange in the body is
    13·1 answer
  • Which activities are ways to reduce the negative impacts humans have on Earths resources? Select two options
    9·2 answers
  • What is the difference between an ion and an atom?
    15·2 answers
  • Convection in the upper mantle
    7·2 answers
  • Describe the difference between genotype and phenotype
    7·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • 31. Because trees live many years, they are:
    8·1 answer
  • Which kind of action is a cause of air pollution? A. Trash is dropped in a national wildlife preserve. B. Poisons are released i
    11·2 answers
  • The correct sequence between genes and their phenotypic expression is
    5·1 answer
  • Please help me please find the answer​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!