1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
salantis [7]
3 years ago
5

What are the names of 2 organelles that you would find in a plant cell and not in an animal cell? Why do you think they would be

in a plant cell and not an animal cell?
Biology
1 answer:
olya-2409 [2.1K]3 years ago
4 0

Answer:

1. chlorophyll : because animals cannot produce their own food

2. Tonoplast: it is a membrane that surrounds the large vacuole in a mature plant cell and vacuoles are not present in animals cell or if present little

You might be interested in
There are two changes that a substance can undergo that may either be physical changes or chemical changes (depending on the oth
svet-max [94.6K]
The answer is true give brainly pls


3 0
2 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
In which symbiotic relationship does one organism benefit while the other organism is harmed? A. mutualism B. commensalism C. pa
aliya0001 [1]
It's C parasitism 
for example tape worms are segmented flat worms that attach themselves to the inside of the intestine.They get food by eating the hosts of nutrients.While say the cow or pig get a disease,
6 0
3 years ago
I need help plsssssssss someone help
Nonamiya [84]
Its conversion of pyruvate, a process where each molecule loses one carbon atom with the release of carbon dioxide
6 0
2 years ago
Nitrogenous Bases %
Lilit [14]
B not sure look it up
8 0
3 years ago
Other questions:
  • Which supports the idea of this ecosystem being open?
    5·1 answer
  • Many species of mites, such as this one, live on the outer surface of human skin. They obtain their food by eating dead skin cel
    10·2 answers
  • After eating a cricket lunch, describe how part of that meal could provide energy to a muscle in your leg.
    14·1 answer
  • Axonal guidance is the process through which axons reach their proper targets in the brain. Researchers hypothesize that the wil
    5·1 answer
  • During the prophase stage, loosely arranged stands of chromosomes become coiled, shortened and distinct.
    5·1 answer
  • Calcite will scratch gypsum. This is an example of the physical characteristics called ____. a. hardness c. fracture b. streak d
    5·2 answers
  • If you are lactose intolerant and cannot digest milk products it is the result of a mutated message in your
    11·1 answer
  • What is a eukaryote?
    6·2 answers
  • What are DNA and RNA are made of?
    14·1 answer
  • What type of cells do cellular respiration and photosynthesis occur in?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!