1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yuradex [85]
4 years ago
6

Are there more than one air mass if so.PLZ help

Biology
2 answers:
Evgesh-ka [11]4 years ago
3 0
Yes because as you go up in the atmosphere the air get thinner
Papessa [141]4 years ago
3 0
Yes . an air mass is a block of air that causes change in weather in other countries . There are 5 main air masses . These are called Tropical Maritime ( which is associated with hot and wet weather and comes from Portugal ) , Tropical continental  ( hot and dry from Africa ) , Polar Maritime ( cold and wet from the Atlantic  ocean ) , Polar Continental ( cold and dry from Russia ) and Arctic Maritime ( Cold and dry from the Arctic ocean ) .
You might be interested in
What is the importance of the excretory system?
Triss [41]
The excretory system is intended to remove any solid/fluid waste from your body, such as urine.
8 0
3 years ago
Different living things? Lots of variety is...
maw [93]
Plants, animals, germs
7 0
4 years ago
Am I wasting your time?
kondor19780726 [428]
Of course not , also thanks for the free points :)
4 0
3 years ago
Read 2 more answers
1 point
Katena32 [7]

Answer:

Exocytosis

Explanation:

Exocytosis is when a bulk of molecules exit the cell. The arrows indicate that it is leaving the cell.

8 0
3 years ago
The table below shows the fossils found in various layers of an undisturbed rock: Fossils In Rock Layers Layer (from top) Fossil
Anton [14]

Answer:

Please attach table

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • WILL GIVE BRAINLIEST, RATING, AND THANKS!
    12·1 answer
  • One result of ________ over evolutionary time spans is that the alleles that enable individuals to survive and reproduce at a hi
    5·1 answer
  • In order to use a Punnett, square we must know the ___________ of an individual
    12·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Why is there a limit the number of levels that a food chain can reach?
    13·2 answers
  • Which feature is believed to have been the first step in the evolution of land plants from the green algae?
    5·1 answer
  • Which method is often used in the disposal of medical waste
    11·2 answers
  • 2
    8·1 answer
  • What is the next step in the process after a substrate enters the active site of an enzyme?
    8·2 answers
  • 5. Near what geologic features of Jezero Crater will Perseverance land?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!