1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
adelina 88 [10]
3 years ago
7

what is the mass of carbon dioxide which contain the same number of molecules as are contained in 14 gram of oxygen?​

Chemistry
1 answer:
Ratling [72]3 years ago
3 0

Answer:

Mass of CO2 WILL BE ~ 9.33 g

Explanation:

Moles of O2 = 14/18

Let the mass of CO2 be x

Then moles of CO2 will be = x/12

moles of CO2 = moles of O2

x/12 = 14/16

x = 9.33 grams

You might be interested in
Which statement best describes the reaction pathway graph for an exothermic reaction but not an endothermic reaction? It has a h
ruslelena [56]
Answer: "The reactants are higher in energy than the products"

Explanation:

The exothermic reactions are characterized by the release of heat to the surroundings. The reactants lose heat that is delivered to the surroundings which implies that the products will be lower in energy than the reactants.

The hills that you can see in a reaction energy diagram are not related with the final change of energy. The hills are an indication of the activation energy needed to start the reaction, but they do not measure the change of energy from the products to the reactants.

The enthalpy that is a state variable that identifies the content of heat. Then the change of enthalpy for the exothermic reactions is negative, meaning that the energy of the products is lower than the energy of the reactants. 
3 0
4 years ago
Read 2 more answers
How do we use particle theory to explain physical properties of matter??<br>thank you!!​
olchik [2.2K]
The properties of matter can best be explained using a model in which all materials are composed of tiny particles (atoms, molecules and ions). There is empty space between particles and particles are constantly moving (their speed is changed by temperature).
8 0
3 years ago
A compound with the molecular formula C10H10O4 produces a 1H NMR spectrum that exhibits only two signals, both singlets. One sig
Kamila [148]

Answer:

The attached figure shows the structure of dimethyl terephthalate.

Explanation:

Dimethyl terephthalate is a compound whose formula is C6H4 (COOCH3) 2. It is a diester produced from terephthalic acid and methanol. It is characterized by being a white solid. Another method for the preparation is from p-xylene and methanol, which is characterized by having an oxidation and an esterification.

8 0
4 years ago
How many grams of ethylene (C2H4) are needed to produce 140 grams of carbor<br>dioxide? ​
Leto [7]

Answer:5

Explanation:

just trust me 5

4 0
3 years ago
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
3 years ago
Other questions:
  • If a gas occupies 4.6 L of space 23 Kpa how much do you need to lower the pressure to make the Gas occupy 65% less space
    8·1 answer
  • Help please help help
    14·1 answer
  • A chemist has 2.0 mol of methanol (CH3OH). Molar mass of menthanol is 32.0g/mol. What is the mass, in grams, of the sample
    13·1 answer
  • To power a flashlight for 1 second, we need ____________ of energy
    5·2 answers
  • At 23°C, 85.0 grams of NaNO3(s) are dissolved in 100. grams of H2O(l).
    11·1 answer
  • Uhh ill give brainliest??
    11·1 answer
  • Plz help with quiz I’ll mark brainliest
    10·2 answers
  • Acids reacts with base and produces salt and water represent it in the form of chemical equation
    11·1 answer
  • What is the outcome of hotspots? Question 13 options: Formation of islands Constant volcanic eruptions Divergent boundary intera
    14·1 answer
  • How many grams are in 4.80 mol of sodium chloride ( NaCl )?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!