1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
anyanavicka [17]
3 years ago
11

The photogragh shows a frog in its habitat. The habitat includes pale rocks and darker plants growing on the rocks. The frog has

patternes which make it look like its habitat.
The frog is an example of an organism which survives in which way
Biology
1 answer:
FromTheMoon [43]3 years ago
8 0
A frog is an amphibian so it survive both on land and water
Hope this helps:)
You might be interested in
CAN SOMEONE HELP ME ON 4
OlgaM077 [116]

Answer:

4. The offspring are the result of sexual reproduction

Explanation:

3 0
3 years ago
Read 2 more answers
What do you think of evolution
castortr0y [4]

Answer:

I think of evolution because there is a lot of changes in evolution.

Explanation:

For example, I like to think of evolution when I think about our Ancestors and how they evolve into us today.

8 0
3 years ago
What is a tiny cavity in a living cell called
vaieri [72.5K]

I believe the answer you are looking for is a cell cavity. Also known as: Cavity of cell, or cell space

4 0
3 years ago
What does Tt mean to geneticists
Goshia [24]
It means that the trait is heterozygous. Also, "T" is common used as the letter to represent the trait "Tall".
4 0
3 years ago
Read 2 more answers
Solids will usually sink when placed in their own liquids. Which is an exception?
Marat540 [252]

WATER

Solids will usually sink when placed in their own liquids with the exception of water

Explanation:

Ice (the solid form of water) floats on water that is cooler than 4 degrees centigrade. This is unlike any other material and this phenomenon has been referred to as the ‘water anomaly’.

Most substances will sink in their own liquid because the solid form is denser than the amount of their own liquid that they displace when immersed. This is because the particles in the solid are closely packed together hence there are more particles per volume than in the liquid form.  

Water however, expands at temperatures below 4 degrees and hence ice is less dense than water at 4 degrees and below. The particles in ice are farther apart than particles of water at 4 degrees and below. There is, therefore, more particles per volume in the liquid form of water than in ice – making ice less dense.

Learn More:

For more on 'water anomaly' check out;

brainly.com/question/871737

#LearnWithBrainly

4 0
3 years ago
Other questions:
  • Keiko did an experiment to find out how aspirin affects tissue repair rates in rabbits. Her results indicate that aspirin can he
    11·2 answers
  • What is the differnce between weight and mass
    13·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Every living things inherit what from their parents?
    8·1 answer
  • What are some potentially linked genes you think humans might have?
    8·1 answer
  • How does selective gene expression benefit eukaryotes?
    6·1 answer
  • After this one there's one more, Good luck! ​
    10·1 answer
  • PLS HELP WILL MARK BRAINLYIEST What is a rule for making a positive atom which has positive charge?
    12·2 answers
  • The Earth’s crust is _____________ enough to sustain _____________.
    7·1 answer
  • How many people world-wide generally die during the flu season?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!