1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bogdan [553]
3 years ago
13

Which steps do scientists take when investigating the natural world? Check all that apply. Form a question. Develop a hypothesis

. Make observations. Conduct controlled experiments. Make predictions. Collect data. Analyze data. Develop a conclusion.
Biology
2 answers:
ser-zykov [4K]3 years ago
8 0

All of the above. Hope this helps :)

adelina 88 [10]3 years ago
4 0

Answer:

thks

Explanation:

You might be interested in
Please help me. i’m confused and don’t know the answer
Cerrena [4.2K]

Answer: The correct answer is C: decreased use of fossil fuels.

Explanation: The burning of fossil fuels causes the release of CO2 and other harmful substances into the atmosphere. Fossil fuels are fuels that are burnt by power plants and such to generate power.

3 0
3 years ago
What two things must be present for a mechanical wave to form?
maksim [4K]

Answer:

b.energy andresistence

7 0
3 years ago
Which of the following describes a reason for making a prediction when
abruzzese [7]
A. To understand the nature of an experimental subject
4 0
4 years ago
Read 2 more answers
Now consider a single base mutation in a codon for leucine that creates a codon for phenylalanine. A true reversion changes the
madam [21]

Answer:

options A, B, D and E

Explanation:

leucine codons include: UUA, UUG, CUU, CUC, CUA, CUG

phenylalanine codons include: UUU, UUC.

<u>C</u>UU          

replace C with U to give

UU<u>U</u> phenylalanine codon

replace underlined with A

UUA leucine codon

<u>C</u>UC

replace underlined with U

UU<u>C</u> phenylalanine codon

replace underlined with A or G

UUA, UUG  leucine codons

UU<u>G</u>

replace underlined with U

<u>U</u>UU phenylalanine codons

replace underlined with C

CUU leucine codon

UU<u>A</u>

replace underlined with U or C

<u>U</u>UU or <u>U</u>UC phenylalanine codons

replace U with C

CUU or CUC leucine codons

7 0
3 years ago
The organelle within eukaryotic cells that contains genetic information is the
Nataly_w [17]
The answer is the nucleus
8 0
3 years ago
Other questions:
  • Biology.
    14·2 answers
  • What are proteins made out of? Where are they located in a cell?
    14·2 answers
  • Which cell structures cause the outer surface of the rough endoplasmic reticulum to appear rough?
    12·2 answers
  • While using a microscope to examine the cell of an unknown organism, you see that the cell has a nucleus, a cell wall, ribosomes
    14·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Describe how you can use a Punnett square to predict the probability that offspring will inherit a trait.
    15·1 answer
  • Which two of these characteristics are examples of endoskeletons?
    12·2 answers
  • What is the role of deoxyribonucleic acid (DNA) in organisms?
    9·1 answer
  • Foliated metamorphic rocks have mineral grains that are randomly placed.<br><br> T<br> F
    5·2 answers
  • How do the kidneys maintain homeostasis in the body?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!