1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maxonik [38]
3 years ago
5

PLSSS HELP!! WILL GIVE BRAINLIEST!

Mathematics
2 answers:
Advocard [28]3 years ago
8 0

Answer:

Although it's blurry, I believe y is equal to 3.

Step-by-step explanation:

You can see where x (the horizontal line) = 7, then go up to where the diagonal line meets that point, which is at y (the vertical line) = 3.

miv72 [106K]3 years ago
5 0

Answer:

<h2>y =  2 \frac{11}{12} gallons</h2>

Step-by-step explanation:

The water run at a constant speed with the slope of 5/12.

Slope-intercept form would be y = 5/12x.

So if we were to plug it in the equation,

y = 5/12 (7) = 35/12 or 2 11/12.

Hope this helps ;D

You might be interested in
All real numbers greater thab or equal to 67
sineoko [7]
An equation for that would be.

x => 67
5 0
3 years ago
I need help with one more of these.
nataly862011 [7]
I think it is yz but I and not completely sure
6 0
3 years ago
Read 2 more answers
Let v =LeftAngleBracket 8, negative 1 RightAngleBracket. What is the approximate direction angle of v?
kirill [66]

Answer:

353

Step-by-step explanation:

6 0
3 years ago
Read 2 more answers
what are the two major advantages of experimental research over correlational studies? multiple select question. experiments are
Aloiza [94]

The experimental research has two key advantages over correlational studies.

1. The possibility of random assignment

2. Causal connections can be assumed.

<h3>What benefit does experimental research have over correlational research?</h3>

Correlational studies merely examine the data that already exists, whereas experimental studies give the researcher the opportunity to influence the study's factors. Researchers can make inferences about how changes in one variable affect changes in another through the use of experimental investigations.

The factors in a correlation study are out of the control of the researcher or research team. The researcher merely measures the information she discovers in the outside world. She can then determine whether changes in one are related to changes in the other, or if the two variables are correlated. In such a study, experimenters gather existing data and use statistical methods to examine it, such as economic statistics from governments. The findings of correlation studies can lead to hypotheses that can be verified through a more focused experimental one.

To learn more about correlational research visit:

brainly.com/question/14375687

#SPJ4

4 0
1 year ago
What is a good way find the answer to this?
Natali5045456 [20]
What were you watching there on the tv? My little pony? Adventure time? 
7 0
3 years ago
Other questions:
  • Your math test has 38 questions and is worth 200 points. This test consists of multiple-choice questions worth 4 points each and
    15·1 answer
  • Hal bought a guitar for $117.05 and a set of drums for $252.80. What was the total cost of his purchase?
    11·1 answer
  • In the diagram below, angle 7 equals 61 degrees
    10·2 answers
  • What is a commonly accepted set of assumptions
    5·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Least to greatest djjzhxjxhxjxjx
    14·1 answer
  • If a ∥ b and e ∥ f, what is the value of y?<br><br> 87<br> 88<br> 91<br> 92
    9·1 answer
  • 2(x -1) + 1/2 (4x + 6)=5
    12·1 answer
  • Help algebra 2 please
    7·1 answer
  • A: 37.68<br> B: 6.28 <br> C: 18.84 <br> D: 12.56
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!