1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naddika [18.5K]
3 years ago
14

While a client is being interviewed on her first prenatal visit she states that she has a 4-year-old son who was born at 41 week

s' gestation and a 3-year-old daughter who was born at 35 weeks' gestation. the client lost one pregnancy at 9 weeks and another at 18 weeks. using the gtpal system, how would you record this information?
Biology
1 answer:
Ainat [17]3 years ago
5 0
<span>Would be G5 T1 P1 A2 L2</span>
You might be interested in
Which of these structures do plants and algae have in common?
Kaylis [27]

Answer:

b and c

Explanation:

3 0
3 years ago
Conclusion: (15 points) Use your data to answer the following questions in your own words. Use complete sentences, and be as det
eduard

Answer:Answer below

Explanation:

It's kinda hard to answer without the scenarios present.Wait nvm 

1.  the greenhouse effect is the process by which radiation from a planet's atmosphere warms the planet's surface to a temperature above what it would be without its atmosphere.The greenhouse effect occurs naturally. Lately the greenhouse effect has been magnified due to greenhouse gases emitted into the atmosphere by humans. and global warming is a gradual increase in the overall temperature of the earth's atmosphere generally attributed to the greenhouse effect caused by increased levels of carbon dioxide, CFCs, and other pollutants.Global warming refers to the increase in annual average temperatures across the globe. As the amount of greenhouse gases in the atmosphere increases, the planet becomes warmer and warmer on average.

2. atmospheric carbon dioxide acts as a thermostat in regulating the temperature of Earth

3. fossil fuels like coal oil and natural gasses

3 0
3 years ago
A ___ is a type of turbine used to capture the energy of moving air
sdas [7]

a windmill collects energy from the wind

6 0
3 years ago
Read 2 more answers
Whats the middle of a cell called
AlexFokin [52]
Nucleus’s it acts like the brain!
3 0
3 years ago
Read 2 more answers
The distal end of the humerus has
Vikki [24]

Answer: a. epicondyles

Explanation:

Distally the humerus bone is flattened. It exhibit a prominent bony projection on the medial side it is called as the medial epicondyle of the bone. The lateral epicondyle is present on the lateral side of the distal part of the humerus bone.  

The grasping and powerful muscles of the forearm are attached with the medial epicondyle. It is typically robust and larger as compared to the lateral epicondyle. The lateral epicondyle is attached with the weaker muscles attached posteriorly.

7 0
3 years ago
Other questions:
  • Identify the plant organs seen in the drawing.
    7·1 answer
  • In order to initiate protein synthesis, what conditions must be met? i. The promoter in the mRNA must be accessible ii. The Shin
    12·1 answer
  • 1. Restriction enzymes are
    7·1 answer
  • How do lungs and airways compare among birds and mammals?
    8·1 answer
  • Passive transport moves molecules_____their concentration gradient
    11·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • *<br> What are genes?<br> O carbohydrates<br> O coded messages<br> O proteins<br> O lipids
    7·2 answers
  • Which of the following processes converts glucose molecules to carbon dioxide molecules?
    12·1 answer
  • Which of the following does NOT describe vacuoles?
    5·1 answer
  • Which is true about a daughter cell produced by mitosis
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!