1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ki77a [65]
3 years ago
5

How are the genes split up in sexual reproduction? Use Mendel's laws in your answer.

Biology
1 answer:
Murrr4er [49]3 years ago
5 0

Answer:

https://hobart.k12.in.us/jkousen/Biology/mendel.htm

Explanation:

This site will tell you what you need to know.

You might be interested in
How are predation and competition essential for maintaining a thriving ecosystem?
Elis [28]

Answer:

<u>Both of these are necessary to maintain overpopulation of any species in an ecosystem.</u>

Explanation:

  • Predation is an act in which one organism eats another organism present in the ecosystem.

  • The one eaten is called prey, while the dominant organism is called Predator.

  • Since an ecosystem is made up of many organisms along with the natural resources present in it.

  • This gives rise to different species competing against one another.

  • If one of these species is at a certain advantage, their population will rise uncontrollably hence to prevent this a predator plays a major role.

  • On the other hand, competition is a term which describes the harm caused to two different organisms.

  • This is due to the limited number of natural resources like food, water or shelter etc.

  • Organisms who are less likely to adapt according to the changing environment ultimately die.

  • For example, Plant roots over time lessen the amount of nitrogen present in the soil, causing the neighboring plant to die.
8 0
3 years ago
What is the difference between a
Alika [10]

Answer: B

Explanation:

malignant tumours spread and cause cancers, benign tumours are non-cancerous

3 0
2 years ago
What conditions would you look for if you were looking for life on moons or other planets besides earth
Anna007 [38]
The most common condition is whether or not there is a source of water on the planet
6 0
2 years ago
In oxidation is needed to create a chemical reaction
kolezko [41]

Oxygen or an oxidizing agent to receive electrons must be present for oxidation to occur in chemical reactions

7 0
2 years ago
Mangrove forests have been used to create _____.
evablogger [386]

Answer: All of above

Explanation: Mangrove forests have many things within it so it could be allowed to use all of these because your could do all of these things in your natural life using mangrove forests.

3 0
2 years ago
Read 2 more answers
Other questions:
  • Do scientists Know what is causing El Niño?
    14·1 answer
  • How does pseudoscience differ from science?
    8·2 answers
  • How are dry climate regions identified?
    10·2 answers
  • What could be a result of an injury to the dorsal column?
    6·1 answer
  • People don't die from hiv/aids <br> why do they eventually die?
    8·2 answers
  • Describe the structure and components of a DNA molecule
    7·1 answer
  • In algae and plants, photosynthesis happens in the
    11·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Which statement best describes the difference between photosynthesis and
    6·1 answer
  • Who is the father of genetics and what was his contribution?​
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!